Skip to main content

We narrowed to 4,373 results for: 424

Showing: 601 - 620 of 4373 results
  1. pSLQ1371-sgYAP-10

    Plasmid
    #121424
    Purpose
    sgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.
    Insert
    sgYAP-10 (GTGCTGTCCCAGATGAACGTC)
    Use
    CRISPR and Lentiviral
    Tags
    mCherry
    Expression
    Mammalian
    Promoter
    mouse U6
    Available Since
    April 22, 2019
    Availability
    Academic Institutions and Nonprofits only
  2. pdCas9-humanized

    Plasmid
    #44246
    Purpose
    Expression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdown
    Depositor
    Insert
    dead Cas9 with 3X NLS
    Use
    CRISPR and Retroviral; Vector
    Tags
    3x NLS
    Expression
    Mammalian
    Mutation
    D10A H840A (catalytically inactive)
    Promoter
    MSCV LTR promoter
    Available Since
    April 8, 2013
    Availability
    Academic Institutions and Nonprofits only
  3. pEGFP-Rab21-CCSS

    Plasmid
    #83424
    Purpose
    Mouse Rab21, mutation of the putative COOH-terminal prenylation motif (residues 218 and 219 from C to S). Generated from pEGFP-Rab21 by site-directed mutagenesis.
    Depositor
    Insert
    Rab21 (Rab21 Mouse)
    Tags
    EGFP
    Expression
    Mammalian
    Mutation
    Residues 218 and 219 from C to S (CCSS: TGCTGT -&…
    Promoter
    CMV
    Available Since
    Nov. 16, 2016
    Availability
    Academic Institutions and Nonprofits only
  4. pDGB1alpha11_SulR

    Plasmid
    #186424
    Purpose
    transcriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assembly
    Depositor
    Insert
    SulR
    Use
    Synthetic Biology; Binary vector for escherichia …
    Expression
    Plant
    Mutation
    BsaI and BsmBI sites removed
    Promoter
    Pnos
    Available Since
    Jan. 12, 2023
    Availability
    Academic Institutions and Nonprofits only
Showing: 601 - 620 of 4373 results