We narrowed to 13,645 results for: sequence
-
Plasmid#183904Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_S212N
Plasmid#113951Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, S212N substitutionPromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema3c(S)-Fc-His
Plasmid#72142PurposeExpresses the Sema3C protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-T2A-miniSOG-C-Far
Plasmid#193915PurposeExpresses miniSOG targeted to the plasma membrane of neurons, joined by a T2A cleavage site with mCherry; for AAV productionDepositorInsertminiSOG
UseAAVTagsFarnesylation signal sequence and Flag tagExpressionMammalianPromoterhSynAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema3g.a(L)-AP-His
Plasmid#72025PurposeExpresses the Sema3G, isoform a protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
L-NARS-2
Plasmid#166532PurposescFv of a human scaffold targeting Asparaginyl-tRNA synthetase. Antigen coverage aa 1-458 of 458, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-AARS-51
Plasmid#166539PurposescFv of a human scaffold targeting Alanyl-tRNA synthetase. Antigen coverage aa 1-455 of 968DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-TARS-11
Plasmid#166536PurposescFv of a human scaffold targeting Threonyl-tRNA synthetase. Antigen coverage aa 320-723 of 723DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-WARS-26
Plasmid#166528PurposescFv of a human scaffold targeting Tryptophanyl-tRNA synthetase. Antigen coverage aa 1-1471 of 471, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-AP-His
Plasmid#72029PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R03
Plasmid#46567PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
RAMA-bio
Plasmid#47786PurposeExpresses enzymatically monobiotinylated full-length RAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema3c(S)-AP-His
Plasmid#72016PurposeExpresses the Sema3C protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gr4-T2A-QF2 HDR plasmid
Plasmid#140944PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Gr4 geneDepositorInsertGr4-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Gr4-right-HDR-arm
Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1274
Plasmid#119266PurposeB. subtilis deltaTn7 site and flanking sequence cloned into pACYCDepositorInsertB. subtilis deltaTn7
ExpressionBacterialAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1263
Plasmid#119264PurposeB. subtilis attTn7 site and flanking sequence cloned into pACYCDepositorInsertB. subtilis attTn7
ExpressionBacterialAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pClneoEGFPC RSF-1
Plasmid#66862PurposeExpress GFP-fused C.elegans RSF-1 in mammalian cellsDepositorInsertRSF-1 (rsf-1 Nematode)
TagsGFPExpressionMammalianMutationS18G, S229T, I403T and F563S mutations in RSF-1 c…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP9-bio
Plasmid#47740PurposeExpresses enzymatically monobiotinylated full-length MSP9 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP9
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R05
Plasmid#46568PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
FB005
Plasmid#119678PurposeCoding sequence nptII from E. coli domesticated into pUPD2 with AATG/GCTT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertgeneticin resistance marker
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFS_1112_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23109-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184740Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 2 transcribed by BBa_J23109DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_J
Plasmid#146709PurposeInsect Expression of DmNot1DepositorInsertDmNot1 (Not1 Fly)
ExpressionInsectMutationThree non silent mutations N605S, K759M, G1999S a…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAMAHISTEV_Ab-PiuA
Plasmid#128957Purposeexpresses Acinetobacter baumannii PiuA in E. coliDepositorInsertTonB-dependent siderophore receptor
TagsTEV protease cleavable 7xHis and TamAExpressionBacterialMutationSignal peptide sequence has been removedPromoterT7Available SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
(363) pcDNA3.1-Nup62-Ubc-Flag-EPEA
Plasmid#168098PurposeNucleoporin Nup62 with C-terminal Ubc nanobody tag, Flag tag, and EPEA nanobody tagDepositorInsertNup62-Ubc-Flag-EPEA
TagsEPEA-tag, Flag-tag, and Ubc-TagExpressionMammalianMutationP229A, S283T on Nup62 native sequencePromoterT7/cmvAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only