We narrowed to 8,892 results for: Ott
-
Plasmid#158089PurposeExpresses ACE2 in mammalian cellsDepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-SNAP-hCB2_IRES_EGFP
Plasmid#223506PurposeExpression of CB2 N-terminally fused SNAP-tag, with targeting sequence to boost plasma membrane expression. Coupled with EGFP transfection markerDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR-BLINK2
Plasmid#117075PurposeBLINK2 gene in pDONR vector for Gateway cloning systemDepositorInsertBLINK2
UseGateway cloning systemMutationglutamine 112 changed into aspartate (original LO…Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 GBP (GBP-mEos2)
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e-iSpyMac-BPNLS-P2A-EGFP (LLH528)
Plasmid#208289PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with iSpyMac(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-iSpyMac-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA; mutations in iSpyMacPromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1951
Plasmid#105868PurposeHigh copy number plasmid containing Hspa1a (synonym Hsp68) MiniPromoter insertDepositorAvailable SinceFeb. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pINTO-N3::hTET3 HxD
Plasmid#136365PurposeExpresses epitope-tagged human TET3 catalytically dead (HxD mutation) in mammalian cellsDepositorInsertTET3 (TET3 Human)
Tags2xStrepTagII, FLAG, and HAExpressionMammalianMutationHxD (H1077Y, D1079A)Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-SHLD3
Plasmid#114126PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-tagged SHLD3DepositorInsertSHLD3 (SHLD3 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT2K-p53DN-T2A-copGFP
Plasmid#109229PurposeFor Tol2 transposon-mediated stable expression of dominant negative p53 and copGFPDepositorInsertdominant negative p53 (Trp53 Mouse)
TagscopGFPExpressionMammalianMutationdominant negative p53PromoterCAGGSAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIP12-V2_A755-A841
Plasmid#194759PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJuly 19, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
miniTol2 x EF1a_EKAREN5 + PGK-puro
Plasmid#167817PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT
Plasmid#132667PurposeExpresses hypoxia-inducible Cas9 and TdT in mammalian cells.DepositorInsertCas9-ODD-T2A-TdT (DNTT Streptococcus pyogenes, Human)
ExpressionMammalianPromoter4xHRE_YB TATAAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpCas9(D10A)-BPNLS-P2A-EGFP (NK350)
Plasmid#208292PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpCas9 A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpCas9(D10A)PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only