We narrowed to 9,849 results for: EPO
-
Plasmid#60797PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains IL6R 3' UTR and mutated miR-155 sitesDepositorInsertIL6R 3'UTR and mutated miR-155 binding site (IL6R Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6-YFP
Plasmid#50483Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
UseTagsYFP fusion in M3-M4 loop (after residue A405)ExpressionMammalianMutationGly-Ala-Gly flexible linker flanking the YFP open…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorTagsExpressionMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-miR-375-mutA-E
Plasmid#53754PurposeLuciferase reporter assay for CIP2A with point mutation on miR-375 binding sitesDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseTagsExpressionMutationMutation on miR-375 binding site A-E (refer to ci…PromoterAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter perisylvian polymicrogyria
Plasmid#52299PurposeReporter for mutated human GPR56 exon 1m promoter activity. It contains a 15-bp deletion in a conserved noncoding element. The mutated human GPR56 e1m promoter was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseTagsExpressionMutation15-bp deletion in the promoterPromoterHuman GPR56 e1m promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3-CFP
Plasmid#50485Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChRBeta3 subunit, isoform 1 (Chrnb3 Mouse)
UseTagsCFPExpressionMammalianMutationCFP fusion in M3-M4 loop (after residue P379). O…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
UseTagsExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…PromoterAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-YFP-Rb-IRES-blasticidin
Plasmid#223964PurposeFluorescent reporter with exogenous RbDepositorUseLentiviralTagsYFPExpressionMammalianMutationPromoterEF-1aAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12R-IRES-mCherry
Plasmid#221023PurposeFluorescent reporter for expressing the KRAS G12R mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12S-IRES-mCherry
Plasmid#221024PurposeFluorescent reporter for expressing the KRAS G12S mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12V-IRES-mCherry
Plasmid#221025PurposeFluorescent reporter for expressing the KRAS G12V mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-WT-IRES-mCherry
Plasmid#221019PurposeFluorescent reporter for expressing the KRAS wildtype CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12A-IRES-mCherry
Plasmid#221020PurposeFluorescent reporter for expressing the KRAS G12A mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12C-IRES-mCherry
Plasmid#221021PurposeFluorescent reporter for expressing the KRAS G12C mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225591PurposeAAV transgene plasmid with hSyn promoter for expression of catalytically dead TRIM21 RING(I18R+M72E)-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianMutationPromoterhSynAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
UseTagsExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…PromoterAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220609PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianMutationPromoterhSynAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTSmut-cox8A(XXXX)-GFP-IRES-mCherry
Plasmid#226104PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) with mutations that impair recognition by SIFI for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
UseTagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…PromoterAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 XBB.1.16 F456L
Plasmid#212455PurposeEncodes SARS-CoV-2 variant XBB.1.16 Spike F456L for pseudovirus productionDepositorInsertSARS-CoV-2 Spike XBB.1.16 F456L (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-miRFP680-NES-p2A-ezrin-T567A-mRuby3-IRES-Neo
Plasmid#222637PurposeEzrin activation reporter, T567 phosphorylation deficientDepositorInsertmiRFP680-NES-p2A-ezrin-T567A-mRuby3 (EZR Human)
UseLentiviralTagsmRuby3ExpressionMutationT567APromoterEF1aAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A S1859A
Plasmid#169826PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K, PKA, and Erk1/2 phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A S1859A; TCCC -> AGTC silent mutat…PromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R2187A
Plasmid#169827PurposeExpresses C-terminal flag-tagged CAD with mutation at reported trimerization interface of the ATCase domain of CADDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationR2187A, T456A S1406A S1859A; TCCC -> AGTC sile…PromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD H1734A H1741A
Plasmid#169830PurposeExpresses C-terminal flag-tagged CAD with mutations at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationH1734A H1741A; TCCC -> AGTC silent mutations a…PromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A
Plasmid#169823PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and PKA phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A; TCCC -> AGTC silent mutations at…PromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1859A
Plasmid#169824PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1859A; TCCC -> AGTC silent mutations at…PromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only