We narrowed to 7,572 results for: aav
-
Plasmid#182820PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_ER
Plasmid#182821PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_PM
Plasmid#182822PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_cyto
Plasmid#182823PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC11
Plasmid#193174PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GAAGAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC9
Plasmid#193176PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TCGAAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC23
Plasmid#193188PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CTAGAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC22
Plasmid#193187PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CAGTAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC20
Plasmid#193185PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TCAGAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC21
Plasmid#193186PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TTGGAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC17
Plasmid#193182PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TGGTAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC16
Plasmid#193181PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CGTAAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC15
Plasmid#193180PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GTGTAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC14
Plasmid#193179PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GAGAAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC13
Plasmid#193178PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GCTAAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC12
Plasmid#193177PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GTTGAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC10
Plasmid#193175PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CATGAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC7
Plasmid#193172PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CGATAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC6
Plasmid#193171PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GTCAAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC5
Plasmid#193170PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TGACAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC3
Plasmid#193168PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CCAAAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC18
Plasmid#193183PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: GGAAAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC1
Plasmid#193166PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CACAAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC4
Plasmid#193169PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CAACAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar
Plasmid#115640PurposeFor targeted integration and inducible expression of a human NODAL splice variant using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Cyp26a1
Plasmid#185563PurposeAAV construct to ubiquitously express mouse Cyp26a1DepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GCaMP6f
Plasmid#178727PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GCaMP6f
Plasmid#178729PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GCaMP6f
Plasmid#178731PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GCaMP6f
Plasmid#178732PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-dTom
Plasmid#178716PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GFP
Plasmid#178709PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GFP
Plasmid#178710PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GFP
Plasmid#178711PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-G-Cdc42
Plasmid#180582PurposeddGFP sensor of Cdc42DepositorInsertddGFP sensor of Cdc42
UseAAVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_PM
Plasmid#177759PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_ER
Plasmid#177758PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_PM
Plasmid#177755PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_PM
Plasmid#177753PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_ER
Plasmid#177752PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn iCyt_BrEt_SnFR_ER
Plasmid#177756PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn iCyt_BrEt_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_ER
Plasmid#177754PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-LAP1-mCherry
Plasmid#159525PurposeExpresses mCherry from LAP1 promoterDepositorInsertmCherry
UseAAVExpressionMammalianPromoterLAP1Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iAChSnFR-Venus-NULL
Plasmid#137953PurposeExpresses iAChSnFR (non-binding yellow version) under hSynapsin promoterDepositorArticleInsertiAChSnFR (yellow version, non-binding variant)
UseAAVExpressionMammalianMutationcpSFGFP replaced with cpSFVenus; Y140A binding si…PromoterhSynapsinAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
2ERT2-AAVS1 TALEN-L
Plasmid#120544PurposeDrug inducible TALEN targeting the human AAVS1 locus for genome editingDepositorInsertERT2, hAAVS1 1L TALEN
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgIdua.CMV/CB-EGFP
Plasmid#121511PurposeExpresses sgRNA targeting mouse Idua intron 9 (sgIdua).DepositorInsertsgIdua
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgAspa.CMV/CB-EGFP
Plasmid#121510PurposeExpresses sgRNA targeting mouse Aspa intron 2 (sgAspa).DepositorInsertsgAspa
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only