We narrowed to 41,067 results for: kan
-
Plasmid#175595PurposeTet inducible, KAN Resistant, non labelled synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
ExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCHW110035
Plasmid#222444PurposeLevel 0, N-terminal tag module (CCAT-AATG) containing LoxP-mCherry-stop.DepositorInsertLoxP-mCherry-stop
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKEE401
Plasmid#91715PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas5
Plasmid#178878PurposeExpression of human codon-optimized Nlacas5 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas5c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas8
Plasmid#178880PurposeExpression of human codon-optimized NlaCas8 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas8c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas11
Plasmid#178882PurposeExpression of human codon-optimized NlaCas11 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas11c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas7
Plasmid#178879PurposeExpression of human codon-optimized Nlacas7 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas7c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCHW00019
Plasmid#222448PurposeLevel 0, C terminal tag module (TTCG-GCTT) containing GAL4AD-NLS.DepositorInsertGAL4AD-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC155
Plasmid#202274PurposeLevel 2 for strain-specific barcode DNA tag with bc182 through Tn7 bacterial insertion, Spectinomycin and Streptomycin selectable marker and tagBFP fluorescent markerDepositorInsertbc182
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC114
Plasmid#202276PurposeLevel 2 for strain-specific barcode DNA tag with bc141 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc141
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH67131
Plasmid#153223PurposeLevel 1 position 1 containing the Nos promoter, NPTII (Kan resistance), and the Nos terminatorDepositorInsertNos promoter, NPTII, Nos terminator
UseSynthetic BiologyAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCHW00016
Plasmid#222447PurposeLevel 0, C terminal tag module (TTCG-GCTT) containing p65AD-NLS.DepositorInsertp65AD-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pconst #5-RFP
Plasmid#81079Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23110Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #1-RFP
Plasmid#81075Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23119Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #4-RFP
Plasmid#81078Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23107Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-eGFP-NT1-6-gix-6-NT1
Plasmid#81204Purposecontains two target sites consisting of PAM-NT1-6bp-gix psuedo site-6bp-NT1-PAM flanking a kan/pA as previously described in the pCALNL-eGFP plasmidDepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-APEX2-mCherry
Plasmid#188944PurposeMiddle entry vector for Gateway cloning containing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherryDepositorInsertmito-APEX2_p2A_APEX2-H2B_p2A_mCherry
UseMiddle entry vector for gateway (l1-l2)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pconst #3-RFP
Plasmid#81077Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23101Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #2-RFP
Plasmid#81076Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter- BBa_J23104Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBER
Plasmid#62662PurposeDonor vector for tdTomato knock-in via landing padDepositorInsertstdTomato
hygromycin
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGX
Plasmid#62666PurposeDonor vector for Dre knock-in via landing padDepositorInsertDre
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGO
Plasmid#62671PurposeDonor vector for mFTH1 knock-in via landing padDepositorInsertFTH1
UseCre/LoxTagsHAExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
p-ArsRBS2-cre[LVA]-loxPP-syfp2
Plasmid#252621PurposeCre-recombinase based arsenite biosensor. ArsR promoter regulates cre expression, which excises two transcriptional terminators leading to cell fluorescence.DepositorInsertParsR-arsR-cre[LVA] + PrpsL-loxP-TT-loxP-syfp2
Tagscre[LVA]ExpressionBacterialPromoterParsRAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
p-cymR-cre[LVA]-loxPP-eyfp
Plasmid#252620PurposeCumate-inducible Cre recombinase; cumate activates P_cymRC to express cre[LVA], which excises loxP-flanked transcriptional terminators and activates eyfp. Use with Marionette Sensor Collection strainsDepositorInsertcymRAM + PcymRC-cre[LVA] + PW4-loxP-TT-loxP-eyfp
Tagscre[LVA]ExpressionBacterialPromoterPcymRCAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHW00015
Plasmid#222446PurposeLevel 0, C terminal tag module (TTCG-GCTT) containig VP64-NLS.DepositorInsertVP64-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW00014
Plasmid#222445PurposeLevel 0, C terminal tag module (TTCG-GCTT) containing VP16-NLS.DepositorInsertVP16-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW110034
Plasmid#222443PurposeLevel 0, N-terminal tag module (CCAT-AATG) containing LoxP-mCherry.DepositorInsertLoxP-mCherry
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC135
Plasmid#202262PurposeLevel 2 for strain-specific barcode DNA tag with bc162 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc162
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC113
Plasmid#202275PurposeLevel 2 for strain-specific barcode DNA tag with bc140 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc140
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC115
Plasmid#202277PurposeLevel 2 for strain-specific barcode DNA tag with bc142 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc142
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC117
Plasmid#202278PurposeLevel 2 for strain-specific barcode DNA tag with bc144 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc144
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC118
Plasmid#202279PurposeLevel 2 for strain-specific barcode DNA tag with bc145 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc145
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC119
Plasmid#202280PurposeLevel 2 for strain-specific barcode DNA tag with bc146 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc146
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC108
Plasmid#202247PurposeLevel 2 for strain-specific barcode DNA tag with bc135 through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc135
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC160
Plasmid#202248PurposeLevel 2 for strain-specific barcode DNA tag with bc187 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc187
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC161
Plasmid#202249PurposeLevel 2 for strain-specific barcode DNA tag with bc188 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc188
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC162
Plasmid#202250PurposeLevel 2 for strain-specific barcode DNA tag with bc189 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc189
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC124
Plasmid#202251PurposeLevel 2 for strain-specific barcode DNA tag with bc151 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc151
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC125
Plasmid#202252PurposeLevel 2 for strain-specific barcode DNA tag with bc152 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc152
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC127
Plasmid#202254PurposeLevel 2 for strain-specific barcode DNA tag with bc154 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc154
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC128
Plasmid#202255PurposeLevel 2 for strain-specific barcode DNA tag with bc155 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc155
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC129
Plasmid#202256PurposeLevel 2 for strain-specific barcode DNA tag with bc156 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc156
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC130
Plasmid#202257PurposeLevel 2 for strain-specific barcode DNA tag with bc157 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc157
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC131
Plasmid#202258PurposeLevel 2 for strain-specific barcode DNA tag with bc158 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc158
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC132
Plasmid#202259PurposeLevel 2 for strain-specific barcode DNA tag with bc159 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc159
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC133
Plasmid#202260PurposeLevel 2 for strain-specific barcode DNA tag with bc160 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc160
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC134
Plasmid#202261PurposeLevel 2 for strain-specific barcode DNA tag with bc161 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc161
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC069
Plasmid#202233PurposeLevel 2 for strain-specific barcode DNA tag with bc096 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc096
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only