We narrowed to 7,064 results for: poly
-
Plasmid#162579PurposeExpresses norovirus GI.1 VP1 protein in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectPromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fireworks GFP[PTC-] (AVA2598)
Plasmid#85445PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-eIF3b
Plasmid#240025PurposeHuman eIF3b for further cloning or expression in insect cells for purificationDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
IL2 F42A pAcGP67a
Plasmid#41807DepositorInsertIL2 (IL2 Human)
Tags6x HisExpressionInsectMutationPhenylalanine 42 to AlaninePromoterPolyhedronAvailable SinceJan. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-hBAI3-HormR-GAIN
Plasmid#37848DepositorInsertBAI3 (BAI3 Human)
UseBaculovirus transfer vectorsTags8xHISMutationHormR and GAIN domains only (aa498–868PromoterPolyhedrinAvailable SinceJuly 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + Needle
Plasmid#84868PurposeBaculovirus Expression of LFn-Needle fusion. The LFn domain acts as a signal sequence that targets proteins for cytosolic translocation via the co-administered protective antigen (PA) channel proteinDepositorInsertsLFn
Needle
UseBaculovirusTags6xHisExpressionInsectPromoterPolyhedrinAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA-CAG Donor
Plasmid#241374PurposeBxb1-GA donor plasmid with CAG promoter, WPRE and polyA signal for constitutive transgene expression (empty)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_luciferase
Plasmid#135475PurposeEncodes Marburg virus minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, luciferase reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW212
Plasmid#172196PurposeP1 integration cassette for AT110 Polymerase for integration onto Orthorep for Nanobody evolution with different restriction sitesDepositorInsertp10B2-AT110
ExpressionYeastPromoter10B2 (P1 specific promoter)Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only