We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#244240PurposeCRISPR/Cas9 donor plasmid to tag human histone H3.2 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
miniCGBE1-NG (pBM1182)
Plasmid#140257PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_NG-P2A-EGFPDepositorInsertBE4max(R33A)_NG-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, NG mutations in SpCas9, D10A in…PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
SunTagng14aa
Plasmid#106439PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianPromoterNoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-N
Plasmid#176649PurposeExpresses N-terminus of PE2 in mammalian cellsDepositorInsertsN-terminus of PE2
Artificial SD
UseAAVTagsSV40 NLSExpressionMammalianPromoterCMV and NoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE4max(R33A) (pBM608)
Plasmid#140251PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9-UGI-UGI-P2A-EGFPDepositorInsertBE4max(R33A)
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCCR5
Plasmid#83930PurposeLentiviral vector expressing an sgRNA targeting CCR5 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCCR5
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Ca9-WPRE
Plasmid#87874PurposeTransfer plasmid for the production of lentiviral vectorsDepositorInsertspCas9
UseLentiviralTagsnlsMutationHuman codon-optimizedPromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM_H1.2_HaloTag
Plasmid#247481PurposeCRISPR/Cas9 donor plasmid to tag human histone H1.2 with Halo tagDepositorAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEM_H1.0_HaloTag
Plasmid#247483PurposeCRISPR/Cas9 donor plasmid to tag human histone H1.0 with Halo tagDepositorAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEM_H1.2_mAID_mClover
Plasmid#247486PurposeCRISPR/Cas9 donor plasmid to tag human histone H1.2 with mAID-mCloverDepositorAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor RUNX3-P2A-tdTomato
Plasmid#246655PurposeDonor plasmid for Crispr/Cas9 gene editing of the human RUNX3 locusDepositorInsertP2A-tdTomato flanked by RUNX3 homology regions (RUNX3 Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor NTRK1-P2A-tdTomato
Plasmid#246653PurposeDonor plasmid for Crispr/Cas9 gene editing of the human NTRK1 locusDepositorInsertP2A-tdTomato flanked by NTRK1 homology regions (NTRK1 Synthetic, Human)
UseCRISPRExpressionMammalianMutationtdTomato was altered to contain a silent SAL1 res…Available SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only