We narrowed to 13,228 results for: sequence
-
Plasmid#218567PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationDeletion genomic sequence from 132nt-221ntAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔ1):GFP
Plasmid#218566PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationDeletion genomic sequence from 58nt-147ntAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNoT7
Plasmid#218168PurposepET31b plasmid with short insert lacking T7 and ribosome binding sites as controlDepositorInsertShort sequence, mutated RBS and T7 sites
ExpressionBacterialPromoterNA - mutated T7Available SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN007
Plasmid#220048PurposeReporter plasmid that encodes for the GFP fused to an N-terminal flag-HA epitope. A stop codon is inserted between the epitope tag and the gfp sequence to terminate GFP translation.DepositorInsertflag-HA-stop-GFP
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
MBP-3C-hTspan12LEL(118-218)_pAcGP67a
Plasmid#216383PurposeBaculovirus transfer vector to secrete human Tspan12 LEL (residues 118-218) fused to MBPDepositorInsertTetraspanin-12 (TSPAN12 Human)
UseBaculovirusTagsGP64 signal sequence-MBP-3CExpressionInsectPromoterPolyhedrinAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL661-TTTA
Plasmid#215865PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL661 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-TTTA
Plasmid#215857PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL714-TTTA
Plasmid#215867PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL714 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pxyl-rsaA
Plasmid#207250PurposeIntegrative plasmid for expressing rsaA gene (incl. its promoter) in Caulobacter crescentus at native Pxyl promoter regionDepositorInsertrsaA (promoter to codon sequence)
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864-TTTA
Plasmid#215859PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864R-TTTA
Plasmid#215861PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864R with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL554-TTTA
Plasmid#215863PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL554 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPath-BGC08-native
Plasmid#200004PurposeBGC08 pathway. Native promoter and CDS sequenceDepositorInsertPathways
ExpressionBacterialAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHB1
Plasmid#204668PurposepUC19 containing the LL-FRT-erm-FRT-spacer sequence which serves as template for BarSeq deletion constructsDepositorInsertFRT-erm-FRT
UseSynthetic BiologyAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
LI D-E TurboID-GFP
Plasmid#209387PurposeGolden Gate LI D-E moduleDepositorTypeEmpty backboneUseCloning vectorMutationTurboID gene sequence C249AAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPath-BGC08-pT7native
Plasmid#200005PurposeBGC08 pathway. pT7-native CDS sequenceDepositorInsertPathways
ExpressionBacterialAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF mito-PAcGFP
Plasmid#188905PurposeExpresses mitochondrial photoactivatable GFPDepositorInsertmitochondrial photoactivatable GFP
TagsMitochondrial leader sequence: MSVLTPLLLRGLTGSARR…ExpressionMammalianAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only