We narrowed to 10,848 results for: ENA
-
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneExpressionMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 9
Plasmid#175817PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 9 (AT5G03070.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 9 (IMPA-9 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneExpressionMutationPromoternoneAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral_394-543-V5His6_D
Plasmid#146134PurposeInsect Expression of DmTral_394-543DepositorInsertDmTral_394-543 (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations (nucleotides A198C, A387G) a…PromoterAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21EE23KR42EF44A-V5His6_C
Plasmid#146071PurposeInsect Expression of DmTral-LSmR21EE23KR42EF44ADepositorInsertDmTral-LSmR21EE23KR42EF44A (tral Fly)
UseTagsExpressionInsectMutationR21E, E23K, R42E, F44A. Additionally, one silent …PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R42EF44A_C
Plasmid#146061PurposeInsect Expression of DmTral-R42EF44ADepositorInsertDmTral-R42EF44A (tral Fly)
UseTagsExpressionInsectMutationR42E, F44A. Additionally, two silent mutations A1…PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-LSm-R21EE23KS13AI15A-V5His6_C
Plasmid#146049PurposeInsect Expression of DmTral-LSmR21EE23KS13AI15ADepositorInsertDmTral-LSmR21EE23KS13AI15A (tral Fly)
UseTagsExpressionInsectMutationS13A, I15A, R21E, E23K, one silent mutation A198C…PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Budding Yeast, Synthetic, Mouse)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL10Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Apc-g1)-PGKpuroBFP-W
Plasmid#105022PurposeLentiviral gRNA plasmid targeting mouse Apc , co-expression of TagBFPDepositorInsertApc (Apc Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorInsertgRNA targeting Hgs (Hgs Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-624-5p
Plasmid#103681PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-624-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-624-5p target (MIR624 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-942-3p
Plasmid#103758PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-942-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-942-3p target (MIR942 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-942-5p
Plasmid#103759PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-942-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-942-5p target (MIR942 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-885-5p
Plasmid#103745PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-885-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-885-5p target (MIR885 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-744-3p
Plasmid#103726PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-744-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-744-3p target (MIR744 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-758-3p
Plasmid#103728PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-758-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-758-3p target (MIR758 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-758-5p
Plasmid#103729PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-758-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-758-5p target (MIR758 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-765
Plasmid#103730PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-765 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-765 target (MIR765 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-766-3p
Plasmid#103731PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-766-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-766-3p target (MIR766 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only