We narrowed to 7,005 results for: mcherry
-
Plasmid#170387PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Negative Control Binder
Plasmid#179140PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9) and an additionional A70Q mutation greatly reduces affinity for SsrA peptideDepositorInsertSspB
TagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9. Addi…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
TC1316
Plasmid#164883PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd-mCherry, ADARdd embeded in loop3DepositorInsertdcas13d-ADARdd
ExpressionMammalianMutationdCas13d L560-G586 deletedPromoterCMV, T7Available SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-TRIM21
Plasmid#207838PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsTagsweak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorInsertCIB1-VP64 (CIB1 Mustard Weed)
TagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
cpLID-micro
Plasmid#168995Purposecircularly permuted LOV2 based optical dimerization system (ssrA-cpLOV2 and sspB)DepositorInsertmCh-sspB-T2A-cpLID-CAAX
ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
vYM133_PB-pEF-osTIR1-T2A-iaaH-T2A-mGFPmut3-mAID-iCasp9-T2A-mCh-AID-BlastR
Plasmid#160046PurposeFor expressing the full paradoxical circuitDepositorInsertsosTIR1
iaaH
iCasp9
BlastR
UseSynthetic BiologyTagsmAID, mCherry, and mGFPmut3ExpressionMammalianPromoterno promoter, T2A is used and pEF1sAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCKC776
Plasmid#226627PurposepiggyBAC 4xHRE YB_TATA hCas9-T2A-G/C-biased1DepositorInserts4x HRE_YB TATA, SpCas9, oxygen-dependent degron, T2A, G/C-biased1 variant of TdT (DNTT Human, S. pyogenes)
EF1a promoter, mCherry
UseSynthetic BiologyTagsoxygen dependent degron (ODD)ExpressionMammalianPromoter4xHRE_YB TATA and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-TRPV1-P2A-DsRed
Plasmid#200830PurposeTransduce all neuron types with AAV to express TRPV1 along with a DsRed fluorescence reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LiPOP1-NanoLuc
Plasmid#168265PurposeChemo-optogenetic control of necroptotic cell death by coupling LiPOP1 with NanoLuc-aided bioluminescence optogenetic stimulation (NanoLOGS)DepositorInsertMLKL(1-125) (MLKL Human)
TagsmCherry, NanoLuc, CRY2-PHRExpressionMammalianMutationH15A, K16A, R17APromoterCMVAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGAL4-1
Plasmid#46915PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoterDepositorInsertssgGAL4-1
Puromycin resistance and mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONOR223 R2pH-LAMP1-3xFLAG
Plasmid#157941Purposegateway donor vector encoding ratiometric sensor of lysosomal lumenal pHDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
MultiMate 5 colors
Plasmid#206266PurposeExpression of 5 fluorescently labelled proteins in mammalian cells. Can be used as a CRE-donor (MultiBac system)DepositorInsertH2B (H. Sapiens), Actin and Tubulin (B. taurus), mito mCherry (Synthetic), CyOFP1 (E. quadricolor)
UseRecombinant baculovirus production, cre acceptor…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-IV-GFPL10
Plasmid#98704PurposeCre-dependently express GFPL10 fusion using Introvert SwitchDepositorInsertGFPL10
UseAAV and Cre/LoxTagsGFPExpressionMammalianMutationL10: 2609 C->T to remove EcoRI sitePromoterEF1aAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-FoxO1_1R_13A_3D
Plasmid#106279PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent protein and NLSExpressionMammalianMutationDeleted amino acids 401-636, T24A, S209A, H212R, …PromoterEF1a/RPBSAAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCS2+-Y276H PHYB-CAAX
Plasmid#154911Purpose1-621 amino acids of Arabidopsis PHYB (as in construct Addgene ID 154910) with the CAAX membrane moiety tag. Tyrosine residue 276 of PHYB was mutated to Histidine.DepositorInsertPhytochrome B (PHYB Mustard Weed)
UseXenopus/avian/zebrafishTagsCAAX membrane moiety and mCherryExpressionMammalianMutation1-621 amino acids of Arabidopsis PHYB, Tyrosine r…PromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only