We narrowed to 13,600 results for: sequence
-
Plasmid#113948Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTFP1
Plasmid#110195PurposeEncodes for human CXCR4 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-c-myc-optiT1R3 ECD
Plasmid#113960Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-RGS7
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Vglut2 in situ probe
Plasmid#45639DepositorInsertVglut2 in situ probe (Slc17a6 Mouse)
UseIn situMutationfragment contains nt 2477-2993 of slc17a6 (Vglut2…Available SinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
proE-cad670-Luc-mEbox
Plasmid#42084DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -670 to …PromoterE-cadherinAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
plko-shmfn2-mfn2-Rescue
Plasmid#160655Purpose"Rescue mfn2 expression by adding the guide-resistant-mutant mfn2 sequence"DepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCGB3A2_HL-P2A-TagBFP-PGK-NeoR-SCGB3A2_HR
Plasmid#126697Purposedonor vector for targeting a 2A peptide followed by blue fluorescent reporter to the human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertTagBFP
ExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
TagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-HADH2
Plasmid#67863Purposebacterial expression of SDR5C1 (HSD17B10), full coding sequence + N-term. His tag (thrombin site)DepositorAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-Fc-His
Plasmid#72075PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
GA-DEVD-GB-NES
Plasmid#61020Purposegreen ddFP based caspase-3 biosensorDepositorInsertddGFP A and ddGFP B
TagsHindIII and NES sequence LALKLAGLDIGS placed afte…ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX Myc-HA
Plasmid#229499PurposeFor lentiviral expression of Myc coding sequence with an HA tag.DepositorInsertMYC
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRepair-mScI-CTNNB1
Plasmid#153431PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mScarlet-iDepositorInsertCTNNB1 homology arms and mScI coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmScarlet-iAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
RH4-bio
Plasmid#47779PurposeExpresses enzymatically monobiotinylated partial RH4 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RH4 (partial)
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE4RA-P2A-Puro
Plasmid#112672PurposeLentivirus for constitutive expression of BE4RA in mammalian cells (codon optimized)DepositorInsertBE4RA
UseLentiviralTagsFLAGMutationNLS sequence at the N-terminus and D10APromoterEF1sAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Pro Mut E2
Plasmid#48750PurposeExpression of luciferase driven by mPer2 promoter fragment containing mutated E-box2 (bases -112 to +98 with respect to transcription start site at +1) and SV40 promoter (backbone)DepositorInsertmPer2 promoter/enhancer region containing mutated E-box2 (-112 to +98)
UseLuciferaseMutationMutated E-box2 sequence from CACGTT to GCTAGTAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
EBA181-bio
Plasmid#47744PurposeExpresses enzymatically monobiotinylated full-length EBA181 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised EBA181
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSems leader-ALFA-mXFP-TpoR
Plasmid#222945PurposeExpression of TPOR with ALFAtag and monomeric XFP in mammalian cellsDepositorInsertThrombopoietin receptor (26-635) (MPL Human)
TagsALFAtag, Ig k-chain leader sequence, and mXFPExpressionMammalianMutationmXFP: tryptophan 66 to phenylalanine, TPOR: Signa…PromoterCMVAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flrt2-Fc-His
Plasmid#72074PurposeExpresses the extracellular region of the FLRT2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Synthetic, Human)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
VBS mutant of alpha catenin sensor
Plasmid#71710PurposeThis form of the alpha catenin conformation sensor lacks the vinculin binding site and does not bind vinculin.DepositorInsertalpha-catenin ΔVBS FRET Sensor
TagsECFP and YPETExpressionMammalianMutationDeleted amino acid residues 316-405 in α -catenin…PromoterCMVAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-EPA-DNNNS-DQNRT
Plasmid#128404PurposePeriplasmic expression of P. aeruginosa exotoxin A with DNNNS and DQNRT internal glycosylation sites in E. coliDepositorInsertExotoxin A (toxA P. aeruginosa)
Tags6xHis tag and DsbA signal sequence for periplasmi…ExpressionBacterialMutation242DNNNS246 and 384DQNRT388 engineered glycosylat…PromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only