We narrowed to 7,669 results for: RAP
-
Plasmid#207504PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertIL2RA, HA-GD2-28z_CAR (IL2RA Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-671_HA-GD2-28z_CAR_tNGFR
Plasmid#207484PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-BlastR [M1G]
Plasmid#171805PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_H3
Plasmid#171927PurposeBacterial expression of nanobody VHH_H3, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_H3
TagsHis6ExpressionBacterial and MammalianAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIG-832_NY-ESO-1_TCR_FAS/4-1BB
Plasmid#207495PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/4-1BB, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL
Plasmid#73209PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in endoplasmic reticulum of mammalian cells with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-mCer3-KDEL (MYC Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIG-835_NY-ESO-1_TCR_FAS/MyD88
Plasmid#207498PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/MyD88, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C5
Plasmid#171925PurposeBacterial expression of nanobody VHH_C5, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C5
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C1
Plasmid#171924PurposeBacterial expression of nanobody VHH_C1, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C1
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIG-834_NY-ESO-1_TCR_FAS/IL4R
Plasmid#207497PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/IL4R, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fba_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107582PurposeB. megaterium DSM319 fba promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfba promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pExp-RBD-CHis
Plasmid#195002PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only