We narrowed to 9,742 results for: Tec
-
Plasmid#109188PurposePlasmid for expression of C-terminally 3xFLAG-tagged BRG1 under the control of a p10 promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pJRoC30_Th3.14
Plasmid#188068PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.14)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGAS-HA
Plasmid#186849PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS with N-terminal FLAG and C-terminal HA tag (Adamts1 Human)
UseRetroviralTagsFLAG and HAPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-shR
Plasmid#208358PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22bDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations introduced to render shRNA …PromoterCMVAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-ORP8-H514A-H515A
Plasmid#208360PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8DepositorAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1-delM43;F44I
Plasmid#211579PurposeCMV driven PARP1-delM43;F44I -eGFP expressing construct with IRES-Neomycin selectionDepositorInsertPARP1 (PARP1 Human)
TagseGFPExpressionMammalianMutationContains deletion of M43 and F44IAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
5K-tails-->R GLUT1-GFP
Plasmid#200099Purposehuman GLUT1 with K-->R mutation of 5 lysines on the N- and C-terminal tails with a C-terminal tag in pQCXIP vectorDepositorInsertGLUT1 (SLC2A1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationK-->R mutations of amino acids 6, 7, 451, 456,…PromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo
Plasmid#191397PurposesgRNA targeting alpha-satellites on human chromosome 9DepositorInsertsgRNA targeting alpha satellites on human chromosome 9
UseLentiviralExpressionMammalianPromoterU6Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-p65
Plasmid#183929PurposeOptogenetic PHR domain coupled to GFP and p65 activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP ratAPOBEC1 L173A/G227A
Plasmid#167169PurposeExpresses rat APOBEC1 L173A/G227A in mammalian cells. Please note that this does not express GFP.DepositorArticleInsertAPOBEC1 (Apobec1 Rat)
ExpressionMammalianMutationchanged Leucine 173 to Alanine; changed Glycine 2…PromoterCMV promoterAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP-INPP5E(D556A)
Plasmid#183678PurposeRecruitable human type IV 5-phosphatase enzyme (catalytically inactive)DepositorInsertINPP5E (INPP5E Human)
TagsmRFP-FKBP12(1-108)ExpressionMammalianMutationC641A, D556APromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113D
Plasmid#107161PurposeFor mammalian expression of Flag-hPKL S113DDepositorInsertFlag-hPKL S113D (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to aspartatePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113A
Plasmid#107160PurposeFor mammalian expression of Flag-hPKL S113ADepositorInsertFlag-hPKL S113A (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to alaninePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS2_HindIII
Plasmid#65666PurposeFLAG-HA expression vector with RBPMS2 carrying mutation to introduce HindIII siteDepositorInsertRBPMS2 (RBPMS2 Human)
TagsFLAG HAExpressionMammalianMutationintroduced HindIII site (final goal to exchange F…PromoterCMV, 2x TetAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-Med25-VWA
Plasmid#64772PurposeMammalian expression of Flag-tagged Med25-VWADepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS302D
Plasmid#62529PurposeSerine 302 of Drosha is mutated to aspartic acidDepositorInserthuman Drosha with serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 302 to aspartic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E
Plasmid#62528PurposeSerine 300 of Drosha is mutated to glutamic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PHO5-GFP-2xOsh2 PH domain EE mutation
Plasmid#58830PurposeExpresses GFP-Tagged and mutated Osh2 PH domain in yeastDepositorInsert2 x Osh2 PH domain (OSH2 Budding Yeast)
TagsGFP and MycExpressionYeastMutationchanged Lysine 307 to Glutamate and Arginine 309 …PromoterPHO5Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only