We narrowed to 7,227 results for: Ank;
-
Plasmid#79060PurposeRetroviral expression of 3xFLAG tagged, nuclear localized wild-type TPP1-OB folding domainDepositorInsertTPP1 (TPP1 Human)
UseRetroviralTags3xFLAG and NLSExpressionMammalianMutationWild-type TPP-OB folding domainPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001146573)
Plasmid#76473Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001145029)
Plasmid#76474Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001145147)
Plasmid#76475Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-TetOn-mCherry-OAZ1_FS-YFP
Plasmid#232356PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)DepositorInsertOAZ1 derived polyamine sensing module (OAZ1 Human)
UseLentiviralTagseYFP and mCherryExpressionMammalianPromoterTRE3GAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CENPA
Plasmid#227283PurposeDonor template for mStayGold insertion into the N-terminus of the CENPA locus. For centromere visualization. To be co-transfected with sgRNA plasmid px330-CENPA (Addgene #227282)DepositorInsertCENPA Homology Arms flanking a mStayGold Tag (CENPA Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mNeongreen
Plasmid#169226PurposeTargeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasS-RLuc8
Plasmid#140980PurposeEncodes a G alpha subunit (GNAS2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasS-RLuc8
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-R26-FLEX-mStr
Plasmid#135619PurposeDonor vector for genomic targeting of a CAG-FLEX-mStrawberry cassette to the mouse Rosa26 locusDepositorInsertCAG-FLEX-mStrawberry flanked by Rosa26 homology arms (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-170
Plasmid#22292DepositorInsertSynaptojanin 1_170 (SYNJ1 Human)
TagsFlagExpressionBacterial and MammalianMutationK334R compared to Genbank ID NM_003895Available SinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-MIB1-IRES-Puro
Plasmid#140240PurposeLentiviral vector expressing flag-tagged MIB1DepositorAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only