We narrowed to 15,985 results for: grna
-
Plasmid#128122PurposeCo-expresses sgRNA RUNX, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA RUNX + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA HEK
Plasmid#128123PurposeCo-expresses sgRNA HEK, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA HEK + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9-ScaligD
Plasmid#125688PurposeGene knockout/in for actinomycetesDepositorInsertstreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable sinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro-STING-sh5
Plasmid#127647PurposeKnock-down of human STINGDepositorInsertSTING shRNA (STING1 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGreenPuro-shRNA-Stx3S-C4
Plasmid#99742Purpose3rd generation lentiviral vector expresses shRNA against human Stx3S with a GFP reporter.DepositorInsertshRNA against Stx3S
UseLentiviral and RNAiExpressionMammalianPromoterH1Available sinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Scr shRNA
Plasmid#59299Purposenon-targeting shRNADepositorInsertScr shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSCV FLIPi P2G_Thy1.1 PTEN
Plasmid#19749DepositorAvailable sinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Cerulean-zhang2.0 Weiss full
Plasmid#79383PurposeCas9 gRNA variant to recruit ms2 proteinsDepositorInsertZhang 2.0 + scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_B358c_attB
Plasmid#182146PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertALB_B358c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_A277c_attB
Plasmid#182145PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAlb_A277c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting AAVS1 (AAVS1 Synthetic)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro-humanU6-shRNA FASN
Plasmid#82327Purposeused to silence target human FASN expression via RNA interference (3rd gen lentiviral vector)DepositorInsertshRNA to target Fatty Acid Synthase (FASN) (FASN Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1 Rheb1 shRNA #2
Plasmid#26626DepositorAvailable sinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only