We narrowed to 13,480 results for: LIC
-
Plasmid#186855PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (154-522 a.a.) with C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIRΔWIR
Plasmid#215508PurposeExpresses GFP tagged human ATG2A which has the mutation in LC3 interacting region and lacks WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorAvailable SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-Cdk5rap2-CTD
Plasmid#196855PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to mOrange2. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertmOrange2-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-Cdk5rap2-CTDdeltaCBD
Plasmid#196856PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) laking the centrosome binding domain (deltaCBD) of Cdk5rap2 fused to AcGFP. It cannot displace Cdk5rap2 from centrosomesDepositorInsertAcGFP-Cdk5rap2-CTDdeltaCBD (Cdk5rap2 Rat)
ExpressionMammalianMutationLacking the centrosome-targeting domain (CTD)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (1-416) (K57A)
Plasmid#197124PurposeExpression of kinase-deficient Myc-tagged PSK2 (aa1-416, K57A) / TAOK1 (aa1-416, K57A) in mammalian cellsDepositorInsertTAOK1 (aa1-416, K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to A and deleted C-terminusPromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-F479L
Plasmid#195477PurposepInducer21 plasmid containing the human MEFV gene with the F479L mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged phenylalanine 479 to leucineAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer21-3xFlag-hMEFV-Q426R
Plasmid#195475PurposepInducer21 plasmid containing the human MEFV gene with the Q426R mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged glutamine 426 to arginineAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.RAB
Plasmid#193015PurposePhotoreceptor-specific reporter (CBh promoter, Atp1b2 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
NSS-GFP
Plasmid#163661PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from TNF and TMD and luminal domain from ST6GAL1 in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from TNF…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNN-GFP
Plasmid#163664PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from ST6GAL1, and TMD and luminal domain from TNF in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from ST,…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
NNS-GFP
Plasmid#163666PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail and TMD from TNF, and luminal domain from ST6GAL1 in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from TNF…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only