We narrowed to 7,357 results for: Ank
-
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
Plasmid#186361PurposeEntry clone with ORF encoding the MT-binding domain of Ensconsin fused to 3 copies of GFP in C-terminal, flanked by Gateway recombination sequences.DepositorInsertHuman Ensconsin (MAP7 Human, Synthetic)
UseExpression of a fluorescent microtubule markerTags3xEGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
natMX-ins7
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPG…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-NLS-BirA-2A-mCherry_Ras
Plasmid#80059PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
Tags3X flag tagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2
Plasmid#169216PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
TagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001146403)
Plasmid#76373Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001145394)
Plasmid#76374Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001144884)
Plasmid#76375Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only