We narrowed to 5,431 results for: U6

#149425

The attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.

Omar Akbari

Kandul et al CRISPR J. 2021 Dec;4(6):822-835. doi: 10

March 30, 2022

Academic Institutions and Nonprofits only

#107721

For expression of sgRNA from the U6 promoter with EGFP expression simultaneously

Xingxu Huang

Liu et al Nat Commun. 2018 Jun 14;9(1):2338. doi:

April 18, 2018

Academic Institutions and Nonprofits only

#54467

Encodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for disruption of genes by CRISPR.

David Sibley

Shen et al MBio. 2014 May 13;5(3). pii: e01114-14.

June 24, 2014

Academic Institutions and Nonprofits only

#108871

Expression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafish

Alex Schier

Raj et al Nat Biotechnol. 2018 Mar 28. pii: nbt.41

April 25, 2018

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#27349

Boris Fehse

Weber et al Mol Ther. 2008 Apr . 16(4):698-706.

April 24, 2012

Academic Institutions and Nonprofits only

#62191

col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9 expression. Contains NsiI cloning site for U6-sgRNA cassettes

Lukas Dow

Dow et al Nat Biotechnol. 2015 Apr;33(4):390-4. do

Aug. 10, 2016

Academic Institutions and Nonprofits only

#185060

Ef1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445

Bobby Koeleman

Nov. 7, 2022

Academic Institutions and Nonprofits only

#169238

Expression of gRNA in Culex quinquefasciatus or other mosquitoes

Valentino Gantz

Feng et al Nat Commun. 2021 May 20;12(1):2960. doi:

May 26, 2021

Academic Institutions and Nonprofits only

#219946

Mammalian expression of 2x-deadEGFP(A111V/L202S) and aptamer-gRNAs to correct both mutations for MOBE3-4

Alexis Komor

Cowan et al Nat Biotechnol. 2024 May 21. doi: 10.103

July 30, 2024

Academic Institutions and Nonprofits only