We narrowed to 9,594 results for: CAG
-
Plasmid#186817PurposeMouse Clgn promoter-driven expression of TESMIN-TurboID-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only
-
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.108
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.109
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW228-lenti-sg1-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189944PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg1-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #1
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW403-lenti-sg3-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189952PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg3-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e1
Plasmid#190684PurposesgRNA targeting enhancer 1 of MYCDepositorInsertsgRNA targeting enhancer 1 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_2
Plasmid#190701PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 2
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv6_dPC_2xChromo
Plasmid#179398PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of dPC_2xChromoDepositorInsertdPC_2xChromo
TagsAviTag and EGFPExpressionMammalianPromoterCAGGSAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_5-1
Plasmid#185054PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_3-2DepositorInsertTFAP4_5_1_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_3-2
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA1
Plasmid#180370Purposetargeting mouse Skil/SnoN geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only