We narrowed to 24,867 results for: promoter
-
Plasmid#236507PurposeFor expression of Cingulin (human) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pY002 (pFnCpf1_min)
Plasmid#69975PurposeExpresses FnCpf1 and spacers 1-4 of CRISPR array under artificial promoter. Cas genes are removed.DepositorInsertFnCpf1 locus without Cas genes nd artificial promoter
UseCRISPRExpressionBacterialAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5E TRE-3GV (JDW 1163)
Plasmid#224476PurposeGateway compatible 5' entry clone containing a 3rd generation Tet-On promoterDepositorInsertTRE3GV promoter
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
T/Brachyury-eGFP Rex Neo
Plasmid#21222DepositorInsertBrachyury promoter
UseLentiviralTagseGFPAvailable SinceJuly 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FpG5
Plasmid#69443Purposelentiviral GFP reporter plasmid for high throughput functional detection of active transcriptional regulatory DNAsDepositorInsertsminimal FGF4 promoter
EGFP
Ubiquitin promoter
Hygromycin resistance
UseLentiviralExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-4eCOL2A1
Plasmid#97211PurposeFor cloning of a COL2A1-based, chondrogenesis-responsive promoter, and subcloning this insert into new vectorsDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseVector is designed for cloning and generation of …PromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX317 TEAD2
Plasmid#193686PurposeConstitutive lentiviral expression of TEAD2DepositorInsertTEAD2 (TEAD2 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
flag-hKLF6 (1006)
Plasmid#49488Purposeexpresses human flag tagged KLF6 in mammalian cellsDepositorAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
7TFP CDH1 mutant reporter
Plasmid#91703Purposelentiviral luciferase reporter containing CDH1 promoter with mutant E-boxesDepositorInsertCDH1 mutant promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianMutationmutant E-boxesPromoterCDH1 mutantAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgTrack-BFP
Plasmid#164273PurposeEmpty sgRNA expression vector with co-expression of BFP reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EFSAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-KRAS4A(G12V)
Plasmid#35634DepositorInsertK-Ras4A(G12V) (KRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationGlycine 12 to ValinePromoterPGKAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
scaffold-linker-U6
Plasmid#89639Purposeconstruction of paired sgRNAs driven by two U6 promoters. Vector itself only has one U6 promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
6691 Bicistronic_ires_puro
Plasmid#64335PurposeThis a retroviral expression plasmid with a minimal polylinker followed by IRES and puro resistance geneDepositorTypeEmpty backboneUseRetroviralAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral-His-tagged-PSPH
Plasmid#134786PurposeStable overexpression lentiviral vector of His tagged PSPHDepositorAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX317 SLC2A1
Plasmid#193685PurposeConstitutive lentiviral expression of SLC2A1DepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-FLAG-CRBN-pGK-HYG
Plasmid#107374PurposeLentiviral expression of FLAG-CRBNDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only