We narrowed to 16,006 results for: grna
-
Plasmid#249417PurposepX459-gRNA#1 targeting the 5′ coding region of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable sinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-TMEM217-gRNA#2
Plasmid#249418PurposepX459 plasmid containing gRNA#2 targeting the end of the coding exon of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable sinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-PtALSgRNA
Plasmid#245881PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequenceDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNS1D-sgRNA9-SpR
Plasmid#191092PurposeaTc inducible gRNA expression plasmid with BbsI sites for Golden Gate insertion of crRNA oligos and homology arms for genome integration at NS1D in Synechococcus sp. PCC 7002DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromotertetAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
phH1-GBX2-gRNA
Plasmid#192510PurposeContains gRNA for GBX2DepositorAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
phU6-CDX4-gRNA
Plasmid#192511PurposeContains gRNA for CDX4DepositorAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmU6-CDX1-gRNA
Plasmid#192512PurposeContains gRNA for CDX1DepositorAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
ph7SK-CDX2-gRNA
Plasmid#192513PurposeContains gRNA for CDX2DepositorAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_PSMD1_sgRNA_1
Plasmid#155102Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_AAVS1_sgRNA_4
Plasmid#155101Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_3
Plasmid#155086Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_4
Plasmid#155106Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_4
Plasmid#155087Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_4
Plasmid#155090Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W
Plasmid#208433PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U7Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPKR_2g)-PGKpuro2AmCherry-W
Plasmid#208435PurposeLentiviral gRNA plasmid targeting human PKR gene, co-expression of mCherry tagDepositorInsertPKR (EIF2AK2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U9Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMDA5_2g)-PGKpuro2AmCherry-W
Plasmid#208436PurposeLentiviral gRNA plasmid targeting human MDA5 gene, co-expression of mCherry tagDepositorInsertMDA5 (IFIH1 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U10Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCi-mB2m-sgRNA
Plasmid#154090PurposepQCi backbone with sgRNA targeting murine Beta-2-microglobulinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting murine B2M locus
UseCRISPRExpressionMammalianAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only