We narrowed to 8,946 results for: sgRNA
-
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.PAC
Plasmid#89393PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B (pAVA2834)
Plasmid#254887PurposeLentiviral vector expressing Cas9-P2A-Blasticidin without sgRNA used as backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJS2
Plasmid#253727PurposeCRISPRi system for Pseudomonas aeruginosa expressing sgRNA from the rhamnose-inducible rhaBAD promoterDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-RNAgateDel-sgEIF3D
Plasmid#222137PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-S528D-S529D-sgEIF3D
Plasmid#222127PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-NtermDel-CtermDel-sgEIF3D
Plasmid#222131PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458 ACTB
Plasmid#229975Purposeecnodes for spCas9 and sgRNA targeting last intron of ActinB geneDepositorInsertActBsgRNA and spCas9
UseCRISPRExpressionMammalianAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a11helixDel-sgEIF3D
Plasmid#222135PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-CtermDel-sgEIF3D
Plasmid#222125PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a5helixDel-sgEIF3D
Plasmid#222133PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-S528N-S529N-sgEIF3D
Plasmid#222129PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-TM2Emp-6T_iBlue-ModFlanks
Plasmid#200236PurposeBackbone for cloning longer RNA triggers that activate iSBH-sgRNAsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCB-CRISPRi
Plasmid#221136PurposeCoxiella burnetii CRISPRi plasmid without sgRNA construct. Expresses 3xF-dCas9.DepositorInsert3xF-dCas9
UseCRISPRTags3xFLAGExpressionBacterialPromotercbu1169 promoterAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro KIAA0141/DELE1_sg1
Plasmid#218524PurposesgRNA targeting human KIAA0141/DELE1DepositorInsertDELE1 (DELE1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro KIAA0141/DELE1_sg2
Plasmid#218525PurposesgRNA targeting human KIAA0141/DELE1DepositorInsertDELE1 (DELE1 Human)
UseCRISPR and LentiviralAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTG131
Plasmid#198640PurposeThermosensitive pSC101-based plasmid expressing a sgRNA under the control of the J23119 promoter and Cas9 under the control of the DAPG-inducible PhlF promoterDepositorInsertCas9
ExpressionBacterialPromoterpPhlFAvailable SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only