We narrowed to 14,730 results for: EGF
-
Plasmid#42190DepositorInsertG protein Gamma 3(A73L,L74I,L75S) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationA73L,L74I,L75SPromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_internal PA-TubA1A-IRES-EGFP
Plasmid#255804Purposemammalian expression of PA-tagged human TubA1A(E254A). The PA tag (GVAMPGAEDDVV) is inserted between Ile42 and Gly43 in the flexible loop of TubA1A. An IRES drives expression of EGFP reporter.DepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-VIVIT-EGFP
Plasmid#254430PurposeFor production of AAV containing VIVT-EGFPDepositorInsertVIVIT-Green Fluorescent Protein
UseAAVPromoterGfa2Available SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 2
Plasmid#253764PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 2 with an IRES-EGFP serving as reporter.DepositorAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 1
Plasmid#253763PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 1 with an IRES-EGFP serving as reporter.DepositorAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS-EGFP^PTC-231
Plasmid#254989PurposeExpress EGFP^PTC-231 in mammalian cellsDepositorInsertEGFP^PTC-231
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
tetOFF-EGFP^PTC-231
Plasmid#254991PurposeExpress doxycycline-repressive EGFP^PTC-231 in mammalian cellsDepositorInsertEGFP^PTC-231
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-eGFP-OMP25(MTS)
Plasmid#188661PurposeHaloTag-GFP fusion targeted to mitochondria with OMP25 targeting sequence.DepositorInsertGFP-HALO-OMP25(MTS)
ExpressionMammalianPromoterChicken beta actinAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆HNH)-EGFP
Plasmid#251974PurposeMitochondrial ABE with HNH truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationHNH deletedPromoterGPDAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆REC2)-EGFP
Plasmid#251975PurposeMitochondrial ABE with REC2 truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationREC2 deletedPromoterGPDAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -EGFP
Plasmid#246994PurposeCan be used to generate AAV virus that will express EGFP from EF1α core promoterDepositorInsertEGFP
UseAAVPromoterEF1αAvailable SinceApril 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R168X (pc4748)
Plasmid#248577PurposeMammalian expression plasmid of MeCP2-R168X (aa1- aa167)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R255X (pc4749)
Plasmid#248578PurposeMammalian expression plasmid of MeCP2-R255X (aa1- aa254)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TRE3GS-eGFP
Plasmid#252871PurposeTRE3GS expression plasmid for Flp/FRT recombination expressing eGFPDepositorInserteGFP
ExpressionMammalianPromoterTRE3GSAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HSV
Plasmid#242769PurposeAAV transfer plasmid expressing eGFP-HSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHSVPromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
FRB-mUSH1C-DFCR-pEGFP
Plasmid#251431PurposeMammalian expression vector for expressing the actin-binding motif of mouse harmonin b with an N-terminal FRB and a C-terminal EGFPDepositorInsertThe DFCR fragment (residues 296-728 of Ush1C) (Ush1c Mouse)
TagsEGFP and FRBExpressionMammalianAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-EGFP-PURO
Plasmid#251732PurposeOverexpression construct expressing EGFP-PURO and ORF-BCDepositorInsertEGFP
UseLentiviralAvailable SinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only