We narrowed to 7,266 results for: /1000
-
Plasmid#55782PurposeThis G protein alpha-q construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-q EE YFP (Gnaq Mouse)
TagsThe EE epitope was introduced into the alpha-q se…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Klf2.2A.Nanog-Cherry-pA-pgk-zeo
Plasmid#74919PurposeMammalian expression of mKlf2 and mNanog-mCherryDepositorTagsT2A and mCherryExpressionMammalianPromoterCAGAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-A18G-B/c
Plasmid#246715PurposeEntry plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA
Plasmid#246243PurposeCre dependent flag-tagged Rpl22l1.DepositorInsertRpl22l1 (Rpl22l1 Mouse)
UseAAVTagsMyc-FLAG-T2A-tdTomatoExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-shMfn1-mCherry-CAAX
Plasmid#228740PurposeMembrane-tethered mCherry shRNA targeting Mfn1DepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPC1-AA-FLAG
Plasmid#228904PurposeExpression of mouse MPC1 in which K45 and K46 motif sites were replaced with alanine blocking acetylation with a C terminal FLAG tagDepositorInsertMPC1 (Mpc1 Mouse)
TagsFLAGExpressionMammalianMutationK45 and K46 motif sites were both replaced with a…PromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_STAT1-2_Mutant
Plasmid#194189PurposeIncludes the promoter (1kb) of SMTS with mutated STAT1/2 binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated STAT1/2 site, Region 653-673nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
QKI-7 scFv [N183/15]
Plasmid#190536PurposeMammalian Expression of QKI-7 scFV. Derived from hybridoma N183/15.DepositorInsertQKI-7 (Mus musculus) recombinant scFV (Qki Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV mCgrrf1-V5
Plasmid#175128PurposeLentiviral expression of mouse Cgrrf1-V5DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Budding Yeast, Synthetic, Mouse)
UseSynthetic BiologyExpressionYeastPromoterGAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-Fc-His
Plasmid#72080PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-AP-His
Plasmid#71954PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only