We narrowed to 8,909 results for: sgRNA
-
Plasmid#116926PurposeRetrovirus expressing eGFP with BBSI cloning sites for sgRNADepositorInserteGFP
UseRetroviralPromoterEF1aAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCasso
Plasmid#207530PurposeConditionally-replicating in Pseudomonas plasmid for cytidine base editing based on pS44i8GH-2; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgDepositorInsertcytidine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceFeb. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRubiG-T2A-Cas9
Plasmid#75348PurposeUbiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Perturb-FISH
Plasmid#220626Purposeexpression of gRNAs under U6T7 promoterDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterBsmBIAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC 4-μHOM
Plasmid#113619PurposeReporter for Alt-EJ, variant of EJ7-GFP. Double strand breaks are induced with the 7a & 7h, or 7a & 7i sgRNAs, with CAS9. EJ using 4 nt of microhomology causes a deletion mutation and restores GFPDepositorInsert4-μHOM variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW-IRF4-Puro
Plasmid#123323PurposeLentiviral vector for expression of IRF4 under a Doxycycline inducible promoterDepositorInsertIRF4 (IRF4 Human)
UseLentiviralExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterDoxycycline inducible minimal CMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CjCas9-eGFP-HIF1a
Plasmid#137929PurposeExpression of cjCas9 with Hif1a targeting sgRNADepositorInsertCjCas9
UseAAV and CRISPRTagsSV40NLS-HA-T2A-EGFPPromoterEF-1alphaAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
retro-gRNA-mRFP1
Plasmid#112914PurposeRetrovirus expressing mRFP1 with BBSI cloning sites for sgRNADepositorInsertmRFP1
UseRetroviralPromoterEF1aAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAblo
Plasmid#207528PurposeConditionally-replicating in Pseudomonas plasmid for adenine base editing based on pS44i8GH-2; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgDepositorInsertplasmid for adenine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRubiC-T2A-Cas9
Plasmid#75347PurposeUbiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsmCherry (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pLAT1_Cas9
Plasmid#104906PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceFeb. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT23
Plasmid#223395PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
SiC-V2-Cas9G7
Plasmid#133043PurposeDoxycycline-inducible SiC-V2 vector with Cas9G7 (sgRNA 7 targeting SpCas9 gene). In cells coexpressing Cas9 nuclease, this construct causes self-inactivation/editing of SpCas9 gene upon Dox addition.DepositorInsertTet repressor
UseLentiviralTagsCeruleanAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA-HEK3-Puro
Plasmid#136282PurposeExpresses a guide RNA targeting HEK3 siteDepositorInsertsgRNA-HEK3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only