We narrowed to 2,240 results for: ARP
-
Plasmid#232000PurposeBicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSico p53
Plasmid#12089PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
TFORF2593
Plasmid#142336PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1αAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLU-CMV-Flag-hATG5 E122D
Plasmid#111804PurposeMammalian Expression of hATG5DepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CHFR-PBZ-eGFP
Plasmid#211581PurposeExpressing CHFR PBZ domain fused to eGFPDepositorInsertCHFR PBZ domain (CHFR Human)
TagseGFPExpressionMammalianMutationPBZ domain of the proteinPromoterCMVAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-XRCC1-EGFP-Hygro
Plasmid#176062PurposeEGFP fused to the C-terminus of XRCC1 & a hygromycin resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 P35S:MS2:VPR:Tnos - P35S:dCas9:EDLL:Tnos (GB2085)
Plasmid#160645PurposeModule for the expression of Ms2 protein fused to VPR and dCas9 fused to EDLLDepositorInsertP35s-Ms2:VPR-Tnos-35s-dCas9:EDLL-Tnos
UseSynthetic BiologyExpressionPlantMutationBsmBI sites removedPromoter35S x2Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-Acridone-RS1 (A7)
Plasmid#197566PurposeExpression of Methanomethylophilus alvus (Ma) Acridone RS1 (A7) tRNA synthetase/Pyl-tRNA pair for the encoding of Acridone at TAG codons in HEK293 cellsDepositorInsertsM. alvus PylRS - Acd RS1 (A7)
M. alvus Pyl-tRNA (6) (4x copies)
TagsNoneExpressionMammalianMutationN166A, V168G, W239CPromoterCMV and U6/H1Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (A7)
Plasmid#174078PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLPX-rc [Chronos-GFP]
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2698
Plasmid#142977PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX LYCHOS (GPR155) WT-FLAG
Plasmid#199633PurposeLentiviral construct to stably express LYCHOS (GPR155) WTDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2: Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos-Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1679)
Plasmid#160619PurposeModule for estradiol-inducible expression of the PhiC31 integrase gene and dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertERLexABDGal4AD / PhiC31 / GRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PSMB5-PSMB6-PSMB7
Plasmid#217898PurposeInsect cell expression of human 20S CP proteasome subunit beta type-5 (PSMB5), beta type-6 (PSMB6), and beta type-7 (PSMB7)DepositorAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
Plasmid#160621PurposeTarget for the Nopaline Synthetase Promoter with the MS2 recognition 2.1 loop in position3' in the scaffoldDepositorInsertU6-26:gRNA 4 (pNos): 2.1 aptamer
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 W201E
Plasmid#186471PurposeExpression of human MOSPD2 (mutant W201E, unable to bind lipid droplets) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationW201E (no more binding to lipid droplets)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) WT-myc
Plasmid#199684PurposeTransient expression of LYCHOS (GPR155) WTDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) 4CA-HA
Plasmid#199677PurposeTransient expression of LYCHOS (GPR155) C595.604.629.638A mutantDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationC595.604.629.638 mutated to APromoterCMVAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) ∆Permease-HA
Plasmid#199686PurposeTransient expression of LYCHOS (GPR155) ∆PermeaseDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationDeletion from amino acid 1-369PromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS ∆LED-HA
Plasmid#199682PurposeTransient expression of LYCHOS (GPR155) ∆LED-HADepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationDeletion from amino acid 556-651PromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) FP>IA-HA
Plasmid#199661PurposeTransient expression of LYCHOS (GPR155) FP>IA mutantDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationF43 and P44 mutated to I and APromoterCMVAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-VAPA
Plasmid#255771PurposeHuman VAPA with FLAGDepositorAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) Y551A-HA
Plasmid#199676PurposeTransient expression of LYCHOS (GPR155) Y551A mutantDepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a LZ LED WT-FLAG
Plasmid#199679PurposeBacterial expression of Leucine Zipper (LZ) LYCHOS LED-FlagDepositorInsertLeucine zipper LYCHOS LED WT (GPR155 Human)
Tags6xHis and FlagExpressionBacterialPromoterT7 promoterAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) P44A-HA
Plasmid#199675PurposeTransient expression of LYCHOS (GPR155) P44A mutantDepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Lamp1 FLAG
Plasmid#199750PurposeLentiviral construct to stably express Lamp1DepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) E48Q-HA
Plasmid#199662PurposeTransient expression of LYCHOS (GPR155) E48Q mutantDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) F43I-HA
Plasmid#199674PurposeTransient expression of LYCHOS (GPR155) F43I mutantDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA7 Neo
Plasmid#140543PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX313-TP53-WT
Plasmid#118014PurposeConstitutive expression of wild-type human Tumor Protein p53 (TP53)DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only