We narrowed to 24,135 results for: CRISPR
-
Plasmid#173889PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyAvailable SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -1
Plasmid#173890PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_sgACTA2
Plasmid#63712PurposeExpress sgACTA2 in mammalian cells.DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
CNC3G (CASANOVA-C3 with glycine linkers)
Plasmid#137192PurposeExpresses CNC3G (CASANOVA-C3 with glycine linkers), a blue light dependent NmeCas9 inhibitory proteinDepositorInsertCNC3G (CASANOVA-C3 with glycine linkers)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Utf1 gRNA
Plasmid#128842PurposegRNA for targeting mouse Utf1 locus using CRISPR-cas techniqueDepositorInsertUtf1 gRNA (Utf1 Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available SinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant
Plasmid#101208PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A and Q695APromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-3sgRNA
Plasmid#88850PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-4sgRNA
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC197 - Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variant
Plasmid#101232PurposeBacterial expression plasmid for SpCas9 Cluster 2 + Q926A variantDepositorInsertSpCas9 variant G528A/V583A/E584A/D585A/N588A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationG528A, V583A, E584A, D585A, N588A and Q926APromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP5F5 (orthogonal T7-lac variant)Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant
Plasmid#101229PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N692A, M694A, Q695A an…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only