We narrowed to 13,072 results for: BASE;
-
Plasmid#190878PurposeCre-on expression of soma-targeted QuasAr6a under an neuronal promoterDepositorInsertsomQuasAr6a_EGFP
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-3xnls-Tq-Ca-FLITS
Plasmid#145030PurposepiggyBac vector for expressing a Turquoise calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-Tq-Ca-FLITS
Tags3xnls-Tq-Ca-FLITSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorArticleInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPtet(Tetracycline inducible protein)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-43Q
Plasmid#84352PurposeExpression of the human Huntingtin Exon1 protein containing 43Q in E.coliDepositorInsertHuntingtin Exon 1 (HTT Human)
TagsN-terminal Ssp intein (His-tagged)ExpressionBacterialPromoterT7Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-LivePARBackbone
Plasmid#176526PurposeExpression vector with a BamHI site in-frame with a Gly-Ser linker fused to EGFP; serves as the backbone for PAR binding domain incorporation for LivePARDepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-2
Plasmid#228996PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-12
Plasmid#228999PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-3
Plasmid#228985PurposeFor bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL8 lenti-D10Acas9-3xflag-blast
Plasmid#112134Purposelenti vector encoding D10Acas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-D10ACas9-3Xflag-T2A-Blast-WPRE)DepositorInsertD10Acas9-3xflag-blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A mutant in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-Hygro-EF1A-OB-Linker-eGFP
Plasmid#176068PurposeEGFP fused to the C-terminus of an OB domain & a hygromycin resistance cassetteDepositorInsertOB
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-G3635A-L17-FZY2-S100N-T26I&T77I-UGI-Puro
Plasmid#209645PurposeTo install m.G3635 mutation on mtDNADepositorInsertL17-FZY2-S100N-T26I&T77I
ExpressionMammalianAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only