We narrowed to 27,539 results for: GFP
-
Plasmid#139871PurposeDox-inducible lentiviral expression of human CLIMP63DepositorAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA6.2-GW/EmGFP-miR-SUMO23
Plasmid#31073DepositorAvailable sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKS070 - pCAGGS-3XFLAG-(human)CTCF-eGFP
Plasmid#156448PurposeFor transient expression of human CTCF tagged with eGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman CTCF (CTCF Human)
ExpressionMammalianMutationnoneAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCK017 pDEST exorh:EGFP
Plasmid#195983PurposeTransgenesis backboneDepositorTypeEmpty backboneUseOtherAvailable sinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-GGamma1-GFP2
Plasmid#140989PurposeEncodes a G gamma subunit (GNGT1) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGamma1-GFP2 (GNGT1 Human)
TagsGFP2 and GSAG linkerExpressionMammalianPromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNW-sfGFP(SPS6)
Plasmid#133814PurposeFluorescent protein sfGFP(SPS6) variant for optimized expression in Bacillus mycoides.DepositorInsertsfGFP(SPS6)
UseE.coli/bacillus spp. shuttle vectorExpressionBacterialPromoterPptaAvailable sinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-NLS-mEGFP
Plasmid#105527PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP with a nuclear localisation signalDepositorInsertNucleoplasmin
UseIn vitro transcriptionTagsmEGFPMutationNLS of nucleoplasmin (encoding amino acids KRPAAT…PromoterT7Available sinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDZ274 (pLEU MET25pro MCP-2x-yeGFP)
Plasmid#45929DepositorInsertMCP-2x-yeGFP
Tags2x-yeGFPExpressionYeastPromoterMET25Available sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSCV-CMV-DsRed-IRES-d1EGFP
Plasmid#41942PurposeRetroviral expression of DsRed in mammalian cellsDepositorInsertDsRed
UseRetroviralExpressionMammalianPromoterTREAvailable sinceMay 2, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIP-SFFV-GFP-RELA
Plasmid#196629PurposeExpress GFP-RELADepositorAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EYFP
Plasmid#58855PurposeThe tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertenhanced yellow fluorescent protein
ExpressionMammalianPromoterCMVAvailable sinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TetOn-REEP5-mCherry-eGFP
Plasmid#139870PurposeDox-inducible lentiviral expression of human REEP5DepositorAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-EF1aL-WT_ABCA3-GFP
Plasmid#188548PurposeLentiviral vector allowing for EF1aL-driven constitutive expression of wildtype human ABCA3:GFP fusion proteinDepositorAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mEGFP-CHMP2A
Plasmid#115328Purposeexpresses mEGFP-CHMP2A in mammalian cellsDepositorAvailable sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only