We narrowed to 19,089 results for: iNOS
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65455PurposeCan be used to generate AAV virus that will express EGFP from the CAG promoter under intersectional control by Flp and Cre recombinasesDepositorInsertEGFP
UseAAVTagsExpressionMutationPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-DCV-nCas9-EcKlenow (JO608)
Plasmid#208946PurposeA variant CE1 construct with DCV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertDCV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29(+exo) (LM2938)
Plasmid#208957PurposeA variant CE1 construct with Phi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2E
Plasmid#224441PurposeRep/Cap plasmid for the production of MyoAAV 2E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDQGYQ insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3D
Plasmid#224445PurposeRep/Cap plasmid for the production of MyoAAV 3D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYREL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3E
Plasmid#224446PurposeRep/Cap plasmid for the production of MyoAAV 3E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4B
Plasmid#224449PurposeRep/Cap plasmid for the production of MyoAAV 4B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4D
Plasmid#224451PurposeRep/Cap plasmid for the production of MyoAAV 4D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4C
Plasmid#224450PurposeRep/Cap plasmid for the production of MyoAAV 4C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSM insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3C
Plasmid#224444PurposeRep/Cap plasmid for the production of MyoAAV 3C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3B
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-oScarlet
Plasmid#137137PurposeIntersectional viral expression of oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgATF4-1
Plasmid#202455PurposeExpression of a guide RNA targeting ATF4DepositorInsertATF4 gRNA (ATF4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-EcKlenow fusion - pCMV-T7-PCV2-EcKlenow (JO1421)
Plasmid#217804PurposeUnfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2(ET/TC)-EYFP
Plasmid#137141PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE123T, T159CPromoternEFAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-MSMV-nCas9-EcKlenow (JO661)
Plasmid#208947PurposeA variant CE1 construct with MSMV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertMSMV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-sRGECO
Plasmid#137127PurposeIntersectional viral expression of sRGECO in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only