We narrowed to 23,256 results for: ica;
-
Plasmid#24404DepositorInsertBarkor (ATG14 Human)
TagsEGFPExpressionMammalianMutationDeletion of amino acids 91-180 of the coiled-coil…Available SinceMay 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
p236 pPr-CREM
Plasmid#8404PurposeExpression of Cre from tissue-specific, androgen-inducible probasin promoter, with chimeric/β-globin intron within the Cre coding sequence.DepositorInsertprobasin driven CREM
UseCre/LoxExpressionMammalianMutationmodified CrePromoterProbasin promoterAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-HaloDA1.0-IRES-EGFP-CAAX
Plasmid#234410PurposeExpresses the chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0 and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
ExpressionMammalianPromoterCMVAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-puro_FlnaABD-TS-16flag
Plasmid#234868PurposeExpresses control FlnA-based tension sensor that lacks dimerization domain and therefore does not report tension.DepositorInsertFlnA Actin binding domain, Ig 15, GFP-F40-RFP, FlnaA Ig 16
UseLentiviralTagsGFP, RFP, FLAGExpressionMammalianPromoterCMVAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-puro_FlnaABD-15-TS-16-24flag
Plasmid#234869PurposeExpresses the FlnA actin binding domain and Ig15 , a FRET construct containing GFP-F40-RFP, the FlnA Ig 16 and Ig 24 domains.DepositorInsertFlnA Actin binding domain, Ig 15, GFP-F40-RFP, FlnaA Ig 16, FlnA Ig 24
UseLentiviralTagsGFP, RFP, FLAGExpressionMammalianPromoterCMVAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Orai1-jGCaMP8f
Plasmid#231630PurposeGreen fluorescent reporter of Orai1-associated calcium influxDepositorInsertOrai1-jGCaMP8f (ORAI1 Human, Synthetic)
TagsjGCaMP8fExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP5380 LAMP1-SBP- mCherry-FIREtag
Plasmid#216725PurposeExpresses LAMP1-mCherry-FIREtag in mamallian cellsDepositorInsertLAMP-1 (LAMP1 Human)
TagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2-WPRE
Plasmid#218871PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2
UseAAVExpressionMammalianMutationS99A F102Y F104Y L178SPromoterGFAPAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2/9-CW3SL-mCherry-DrTrkB
Plasmid#184002PurposeAAV production for expression of optically controlled eDrTrkB with N-terminal fusion of mCherryDepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1985 - [1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
Plasmid#159846PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2249 - [1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159847PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4134357
Plasmid#152589PurposeMammalian expression plasmid for SARS-CoV-2 M (membrane)DepositorInsertSARS-CoV-2 M (membrane) (M Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHis-003ExpressionMammalianMutationwtPromoterCMVAvailable SinceJuly 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEBTet-SNAP-Cep78
Plasmid#136827PurposeMammalian expression of the centrosomal protein Cep78 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep78 (CEP78 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-C9ORF80
Plasmid#128418PurposeExpress C9ORF80 in E. coli with a His tag (C-terminal)DepositorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRG/III-hs-MBP-T43NTR-TrxA-H10
Plasmid#121677PurposeBacterial expression of neurotensin receptor fusion proteinDepositorInsertneurotensin receptor (Ntsr1 Rat)
TagsTrxA-H10ExpressionBacterialMutationdeleted amino acids 1-42PromoterlacAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα1(I)
Plasmid#119844PurposeExpresses mouse Type I procollagen α1 chain (Col1a1) with mApple replacing exon 2-3 retaining N-propeptide minor triple helix and N-terminal cleavage siteDepositorInsertType I procollagen α1 chain (Col1a1 Mouse)
TagsmAppleExpressionMammalianMutationCol1a1 exons 2-3 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα2(I)
Plasmid#119840PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with mApple between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagsmAppleExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only