We narrowed to 7,706 results for: alp
-
Plasmid#82298PurposeGateway Donor vector containing MAPK14, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_NRAS_WT
Plasmid#82150PurposeGateway Donor vector containing NRAS , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNF-COMP5AP-AviTag-9xHis
Plasmid#157140PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag CSNK1A1L
Plasmid#20467DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
R713-M52-303: CMV51p> Halotag-NRasHVR
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/10R]
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
Tags10xHis, c-myc, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA1
Plasmid#23471DepositorInsertPHKA1 (PHKA1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK1A1L
Plasmid#23784DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA-plus exon 18a - Short-Cterm - Arginine -in pcDNA3
Plasmid#198915PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a, Short form of alternatively spliced C-teminus, SNP rs2278973 variant Arginine, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
TagsN-terminal GFP, internal double HAExpressionMammalianMutationsnp rs2278973 ArgininePromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:CYP27B1_CE_pISceI
Plasmid#223028PurposeExpress CYP27B1 gene in mesenchymal lineage of Zebrafish.DepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only