We narrowed to 70,205 results for: nin
-
Plasmid#53271PurposeContains the Erwinia herbicola (Pantoea agglomerans) Eho10 genes crtE and crtB, and the Rhodobacter capsulatus crtI gene and thereby produces neurosporene in Escherichia coliDepositorInsertcrtI
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-PHYT
Plasmid#53300PurposeContains Erwinia herbicola Eho10 (Pantoea agglomerans) crtE and crtB genes, and thereby produces phytoene in E. coliDepositorInsertcrtE, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
XE28 XBC 40
Plasmid#16842DepositorAvailable SinceMay 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAL942
Plasmid#119721Purposeprecursor slow-folding rbsB with the mutations Alanine 248 Threonine, Alanine 188 Cysteine and Glutamic acid 246 CysteineDepositorInsertprecusor slow-folding ribose import binding protein, rbsB, mutations A248T, A118C and E246C
TagsnoneExpressionBacterialMutationAlanine 248 to Threonine, Alanine 188 to Cysteine…PromoterT7Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pkk223_EcMutY
Plasmid#213110Purposepkk223 with E coli MutY insertDepositorInsertMutY (adenine glycosylase) (mutY Escherichia coli)
ExpressionBacterialAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
NmMetNI-WT
Plasmid#172114PurposeExpression of MetN and MetI membrane proteinsDepositorInsertsMetN
MetI
Tags10x His Tag and EnterokinaseExpressionBacterialPromoterT7 PromoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA-At
Plasmid#53288PurposeContains crtE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and an lcyB cDNA of Arabidopsis thaliana. Use with pY2F to produce alpha-carotene in E. coli.DepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-NLRC5
Plasmid#37521DepositorAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAC-LYC
Plasmid#53270PurposeContains 3 genes (crtE, crtI, and crtB) of the carotenoid pathway gene cluster of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces lycopene in Escherichia coliDepositorInsertcrtE, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZEAXipi
Plasmid#53287PurposeContains crtE, idi, crtI, crtY, crtB, and crtZ genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces zeaxanthin in E. coliDepositorInsertcrtE, idi, crtY, crtI, crtB, crtZ
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
ChromosomesMembranesandCytoskeleton
Plasmid#62450PurposeMXS_chaining vector with 4 cassettesDepositorInsertsCMV::H2B-TagBFPx3-bGHpA
CMV::Lyn-Ceruleanx3-bGHpA
CMV::mCherryx3-linker-betaActin-bGHpA
CMV::Citrinex3-linker-alphaTubulin-bGHpA
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisPromoterTrcAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
p11_AaC60αβ/C20
Plasmid#229506PurposeExpresses Anthoceros agrestis Chaperonin 60α, Chaperonin 60β, Chaperonin 20DepositorInsertsChaperonin 60α
Chaperonin 60β
Chaperonin 20
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAC-aZEA
Plasmid#53286PurposeContains crtE, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, crtI gene of Rhodobacter capsulatus, and lcyE cDNA of Arabidopsis thaliana and produces alpha-zeacarotene in E. coliDepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPi
Plasmid#127548PurposeEmpty control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertAdenine Phosphorybosyltransferase transcript segment
UseRNAi; Empty controlPromoterUbiquitinAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionPromoterT3 promoterAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTEX150-bio
Plasmid#47788PurposeExpresses enzymatically monobiotinylated full-length PTEX150 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTEX150
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only