We narrowed to 71,223 results for: nin
-
Plasmid#53316PurposeContains Erwinia herbicola Eho10 genes crtE and crtB, together with the pds (crtP) gene of Synechococcus PCC7942 fused to the lacZ gene at the N terminus. Produces zeta-carotene in E. coli.DepositorInsertpds
UseLow copy number bacterial cloning vectorPromoterlazZAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-PHYT
Plasmid#53300PurposeContains Erwinia herbicola Eho10 (Pantoea agglomerans) crtE and crtB genes, and thereby produces phytoene in E. coliDepositorInsertcrtE, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
XE28 XBC 40
Plasmid#16842DepositorAvailable SinceMay 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAL942
Plasmid#119721Purposeprecursor slow-folding rbsB with the mutations Alanine 248 Threonine, Alanine 188 Cysteine and Glutamic acid 246 CysteineDepositorInsertprecusor slow-folding ribose import binding protein, rbsB, mutations A248T, A118C and E246C
TagsnoneExpressionBacterialMutationAlanine 248 to Threonine, Alanine 188 to Cysteine…PromoterT7Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGY49
Plasmid#249719PurposepGY49 is a CRISPR adenine base editing vector with nCas9 and sgRNA cassette, enabling targeted A-to-G conversions at NGG PAM sites in filamentous fungi.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY150
Plasmid#249722PurposepGY150 is a CRISPR adenine base editing vector with the nickase variant of SpCas9-NG (nCas9-NG) and an sgRNA cassette, enabling targeted A-to-G conversions at flexible NG PAM sites in filamentous fungDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pkk223_EcMutY
Plasmid#213110Purposepkk223 with E coli MutY insertDepositorInsertMutY (adenine glycosylase) (mutY Escherichia coli)
ExpressionBacterialAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
NmMetNI-WT
Plasmid#172114PurposeExpression of MetN and MetI membrane proteinsDepositorInsertsMetN
MetI
Tags10x His Tag and EnterokinaseExpressionBacterialPromoterT7 PromoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-NLRC5
Plasmid#37521DepositorAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAC-LYC
Plasmid#53270PurposeContains 3 genes (crtE, crtI, and crtB) of the carotenoid pathway gene cluster of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces lycopene in Escherichia coliDepositorInsertcrtE, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
ChromosomesMembranesandCytoskeleton
Plasmid#62450PurposeMXS_chaining vector with 4 cassettesDepositorInsertsCMV::H2B-TagBFPx3-bGHpA
CMV::Lyn-Ceruleanx3-bGHpA
CMV::mCherryx3-linker-betaActin-bGHpA
CMV::Citrinex3-linker-alphaTubulin-bGHpA
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZEAXipi
Plasmid#53287PurposeContains crtE, idi, crtI, crtY, crtB, and crtZ genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces zeaxanthin in E. coliDepositorInsertcrtE, idi, crtY, crtI, crtB, crtZ
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisPromoterTrcAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA-At
Plasmid#53288PurposeContains crtE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and an lcyB cDNA of Arabidopsis thaliana. Use with pY2F to produce alpha-carotene in E. coli.DepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
p11_AaC60αβ/C20
Plasmid#229506PurposeExpresses Anthoceros agrestis Chaperonin 60α, Chaperonin 60β, Chaperonin 20DepositorInsertsChaperonin 60α
Chaperonin 60β
Chaperonin 20
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAC-aZEA
Plasmid#53286PurposeContains crtE, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, crtI gene of Rhodobacter capsulatus, and lcyE cDNA of Arabidopsis thaliana and produces alpha-zeacarotene in E. coliDepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPi
Plasmid#127548PurposeEmpty control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertAdenine Phosphorybosyltransferase transcript segment
UseRNAi; Empty controlPromoterUbiquitinAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only