We narrowed to 17,757 results for: puro
-
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-TGFa-ScNeo
Plasmid#209895PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV:Flag-CeNL_SV40:PuroR
Plasmid#183039PurposeExpresses the FLAG-tagged CeNL (Blue Nanolantern) in mammalian cells.DepositorInsertCeNL Nanolantern
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV:Flag-YeNL_SV40:PuroR
Plasmid#183041PurposeExpresses the FLAG-tagged YeNL (Yellow Nanolantern) in mammalian cells.DepositorInsertYeNL Nanolantern
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV:Flag-OeNL_SV40:PuroR
Plasmid#183042PurposeExpresses the FLAG-tagged OeNL (Orange Nanolantern) in mammalian cells.DepositorInsertOeNL Nanolantern
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-Nd1-puro
Plasmid#52052PurposeExpresses Nd1 and puromycin resistent gene under control of TetON promoterDepositorInsertNeurod1 (Neurod1 Mouse)
UseLentiviralTagsT2A-and puromycin resistant cassetteExpressionMammalianPromotertet-onAvailable SinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro
Plasmid#208646PurposepcDNA3.1 based empty vector for transient transfection of sgRNA-cas9. U6 promoter ~ puro Res cloned from lentiCRISPRv2 (Addgene#52961), lenti virus sequences not included.DepositorTypeEmpty backboneUseCRISPRTagsClawed frog nucleoplasmin NLS, Flag, Puromycin re…ExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-ultraID-Puro
Plasmid#207726PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a ultraID-2A-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV Puro-CCSP:GFP
Plasmid#68487PurposeRetrovirus expressing GFP driven by CCSP promoterDepositorInsertsPuromycin Resistance
GFP
UseRetroviralExpressionMammalianPromoterCCSP and LTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MjACE2 (Pangolin)
Plasmid#158084PurposeExpresses pangolin ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain
Plasmid#79554PurposeExpression of catalytic domain of mouse Tet2DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR PGK puro
Plasmid#12084PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both puromycin and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CMV-puro
Plasmid#131700Purposeexpresses CMV promoter driving puromycin resistanceDepositorArticleInsertCMV-puro
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-SMCR8
Plasmid#83440PurposeExpresses Cas9 and a gRNA targeting SMCR8DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV Puro-CMV:GFP
Plasmid#68485PurposeRetrovirus expressing GFP driven by CMV promoterDepositorInsertsPuromycin Resistance
GFP
UseRetroviralExpressionMammalianPromoterCMV and LTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdest WDR4 Puro
Plasmid#223062PurposeWDR4 gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only