We narrowed to 15,900 results for: genome
-
Plasmid#121532Purposeexpression of PYL-SfGFP-Emerin, lentivirus vectorDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only
-
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-VP64-dCas9-VP64
Plasmid#232179PurposeLentiviral cassette that expresses 2xVP64-dCas9 fusion in mammalian cellsDepositorInsertVP64-dCas9-VP64
UseLentiviralExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-BLM
Plasmid#80070PurposeExpresses GFP-tagged BLM helicase in mammalian cells (EGFP-C1 backbone)DepositorInsertBLM (BLM Human)
TagsGFPExpressionMammalianMutationIf correct ID, the cDNA is from HeLa and has char…Available SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-goldDn29-P2A-GFP
Plasmid#247153PurposeMammalian expression of a human codon optimized engineered goldDn29 recombinase (efficient and specific variant)DepositorInsertgoldDn29-P2A-GFP
Tags6xHisExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503NPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMK003
Plasmid#236570PurposeCloning vector for PaqCI Golden Gate assembly of ISDra2 guides into ISDra2 plant expression vectorDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAS9PBKS
Plasmid#68371PurposeCbAkt promoter driven Cas9-2A-GFP (from px458)DepositorInsertCas9
Tags2A-EGFPExpressionMammalianPromoterCbAktAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMma PylT_FLAG-PcKRS
Plasmid#140022PurposePlasmid with 4xMmaPylT cassette and MmaPylRS for amber suppression and incorporation of photocaged-lysine; for transient or stable piggyBac-mediated integrationDepositorInsertPcKRS (pylS Methanosarcina bakeri)
TagsFLAGExpressionMammalianMutationM241F, A267S, Y271C, L274MPromoterEF1Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pBAD-HisD-mNG-Ec-Kbp-D9N
Plasmid#178011PurposeBacterial expression of green fluorescent potassium indicator mNG-Ec-Kbp-D9N (KRaION1 mutant D9N)DepositorInsertmNG-Ec-Kbp-D9N
ExpressionBacterialPromoteraraBAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-PYL1-sfGFP-PML
Plasmid#167011Purposeexpression of PYL1-SfGFP-PML, lentivirus vectorDepositorAvailable SinceJune 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR E3 pR8A L3-L2
Plasmid#158735PurposePlant mitoTALEN vector assembly, Entry clone 3 with attL3 L2 (last NN)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR E1 pF8A L1-L4
Plasmid#158731PurposePlant mitoTALEN vector assembly, Entry clone 1 with attR4 R3 (last NN)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR E1 pF5A L1-L4
Plasmid#158728PurposePlant mitoTALEN vector assembly, Entry clone 1 with attR4 R3 (last HD)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR E3 pR6A L3-L2
Plasmid#158733PurposePlant mitoTALEN vector assembly, Entry clone 3 with attL3 L2 (last NG)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR E3 pR7A L3-L2
Plasmid#158734PurposePlant mitoTALEN vector assembly, Entry clone 3 with attL3 L2 (last NI)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR E1 pF6A L1-L4
Plasmid#158729PurposePlant mitoTALEN vector assembly, Entry clone 1 with attR4 R3 (last NG)DepositorInsertTALEN ORF without TAL repeat
UseTALENAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKS021 - pCAGGS-3XFLAG-mKate2-SA1-bpA
Plasmid#156440PurposeFor transient expression of mouse SA1 (= STAG1 or SCC3A) tagged with mKate2DepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK Cas9-2A-Citrine
Plasmid#92393PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.DepositorInsertCas9 2A Citrine
UseCRISPRExpressionMammalianPromoterthymidine kinase promoterAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only