We narrowed to 24,180 results for: CRISPR
-
Plasmid#76082Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRExpressionMammalianAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146035)
Plasmid#76081Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001145294)
Plasmid#76083Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146875)
Plasmid#76084Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147294)
Plasmid#75916Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001146328)
Plasmid#77167Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax NG
Plasmid#187894PurposeAll-in-one prime editor piggyBac transposon with PEmax, NG variantDepositorInsertSpCas9_H840A_KK_NG-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-SpRY
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B Human, S. pyogenes, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001146030)
Plasmid#77053Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001148937)
Plasmid#77054Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Human, S. pyogenes, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ERN1 gRNA (BRDN0001162231)
Plasmid#76409Purpose3rd generation lentiviral gRNA plasmid targeting human ERN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only