We narrowed to 19,814 results for: INO
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.flag
Plasmid#19758DepositorAvailable SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3F
Plasmid#224447PurposeRep/Cap plasmid for the production of MyoAAV 3F, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHASW insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3A
Plasmid#224442PurposeRep/Cap plasmid for the production of MyoAAV 3A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYVGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS2181
Plasmid#158421PurposeAAV plasmid with Ple32 (CLDN5 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN
Plasmid#85754PurposeExpresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).DepositorInsertCsy4-T2A-FokI-dCas9
UseCRISPRTagsCsy4 and FokI fusion via 25 amino acid (GGGGS)5 l…ExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CDK2
Plasmid#172616PurposeExpresses 2xFLAG-2xSTREP-tagged CDK2 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChRmine-oScarlet
Plasmid#137160PurposeIntersectional viral expression of ChRmine-p2a-oScarlet in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChRmine-p2a-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationoScarlet E95DPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 aSyn C141
Plasmid#108866PurposeExpresses human WT alpha synuclein with a C-terminal cysteineDepositorInsertalpha synuclein (SNCA Human)
ExpressionBacterialMutationC141 mutation to allow C-terminal maleimide dye l…PromoterT7Available SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Slc17a7-IRES2-Cre targeting vector
Plasmid#61574PurposeTarget the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) geneDepositorInsertSlc17a7-IRES2-Cre
UseCre/Lox and Mouse TargetingAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MjACE2 (Pangolin)
Plasmid#158084PurposeExpresses pangolin ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
mAC-POLR2A donor (Hygro)
Plasmid#124496PurposeA donor plasmid for tagging the N-terminus of human POLR2A with mAID-mCloverDepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.KD.flag
Plasmid#19759DepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseRetroviralTagsFlagExpressionMammalianMutationD173A (kinase dead)Available SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1E
Plasmid#224439PurposeRep/Cap plasmid for the production of MyoAAV 1E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDTMSK insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
MEK1C222
Plasmid#164638PurposeBacterial expression plasmid for His6-MEK1C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S222C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET32bplus_trxAChEwt
Plasmid#83916PurposeEncodes an E. coli codon optimized version of wild type human acetylcholinesteraseDepositorInsertShort form of hAChE, codon optimised for E.coli expression (ACHE Human, Synthetic)
TagsHis, S-tag, and TRXExpressionBacterialMutationcodon optimised for E.coli expressionPromoterT7 promoterAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only