We narrowed to 7,843 results for: chloramphenicol
-
Plasmid#85126PurposeNSIII -Cm-PkaiB-luc+ (firefly) vector constructed by seamless cloning with Cm casette codon optimized for S7942. PkaiB-luc+ amplified from pAM2105.DepositorInsertPkaiB-luciferase
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-c
Plasmid#53066Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-n
Plasmid#53069Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-n
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-Hsp70-zCreI-mTagBFP2d-2xins (JDW 1002)
Plasmid#229817PurposeA gateway compatible Tol2 destination vector containing the Hsp70 promoter driving Cre and TagBFP followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-hsp70-zCreI-BFP (JDW 1184)
Plasmid#229831PurposeA gateway compatible Tol2 destination vector containing the hsp70 promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
SS-Myc-HexaPro-Foldon (MTK 3a) (pZYW077)
Plasmid#194233PurposeMammalian Toolkit part 3a encoding Jason McClellan lab's 6-proline Spike extracellular domainDepositorInsertCD8a Signal Sequence-Myc Tag-SARS-CoV-2 Spike1-1258 (S Synthetic)
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔPrD(kf)-SNAP
Plasmid#166150PurposeExpression of N. furzeri DDX5ΔPrD(1-535) mutant in E. coliDepositorInsertDDX5ΔPrD(1-535)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔPrD(1-535)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔIDR(kf)-SNAP
Plasmid#166151PurposeExpression of N. furzeri DDX5ΔIDR(1-483) mutant in E. coliDepositorInsertDDX5ΔIDR(1-483)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔIDR(1-483)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE3 HEK3
Plasmid#206273PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE3 HEK3 prime editing.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multi…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-Cas12m-ΔZF
Plasmid#192276PurposeEncodes MmCas12m ΔZF (H549A, C552A) under a constitutive promoterDepositorInsertCas12m ΔZF
UseCRISPRExpressionBacterialMutationH459A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m-ΔZF
Plasmid#192277PurposepCas-dCas12m-ΔZF (D485A, H549A, C552A) under a constitutive promoterDepositorInsertMmdCas12m ΔZF
UseCRISPRExpressionBacterialMutationD485A, H549A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only