We narrowed to 12,778 results for: NUC
-
Plasmid#177276PurposePurification of mouse NLRC4 (90-1024) from insect cellsDepositorInsertNLRC4 (Nlrc4 Mouse)
TagsHIS-SUMO-PreScissionExpressionInsectMutationI586T, N761S, M885V, K915R and F972L- please see …PromoterpolyhedrinAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D301-380
Plasmid#19852DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB1 (human) HIS-tag pET
Plasmid#8520DepositorAvailable SinceJuly 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
IR904: pMVP (L3-L2) pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP2-F404AF407AF409A_V
Plasmid#147813PurposeMammalian Expression of HsDCP2-F404AF407AF409ADepositorInsertHsDCP2-F404AF407AF409A (DCP2 Human)
ExpressionMammalianMutationtwo silent mutations compared to the sequence giv…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe-ER-E2F2-dRb
Plasmid#62805Purposeexpresses an inducible E2F2 mutant that lacks the Rb binding domainDepositorInsertE2F2 (E2F2 Human)
UseRetroviralTagsHA-ErExpressionMammalianMutationdeletion of amino acids 302-437, including the Rb…Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2Flag CMV2-ZO-2-N
Plasmid#27418DepositorInsertZonula Occludens 2 (TJP2 Human)
Tags2xFlagExpressionMammalianMutationDeletion of the carboxy-terminus of ZO-2, so only…Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T12A
Plasmid#47936Purposeexpresses Myc tagged human MOB1 containing T12A mutationDepositorAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-DNM2-W525L
Plasmid#155263PurposeMammalian expression of rat DNM2 fused to HADepositorAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP-Fibrillarin-C1
Plasmid#134538PurposeExpresses YFP-Fibrillarin fusion proteinDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NLS/NES-mut
Plasmid#42002DepositorInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationR930A, R931A, R932A, R934A, F951A, F955A, I958A, …PromoterCMVAvailable SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
CRY-tTA (B702)
Plasmid#92032PurposeExpresses CRY2 (Full length, mutated NLS) fusion with tTA2 'tet-OFF' transcriptional activatorDepositorInsertCRY2 (CRY2 Mustard Weed)
TagstTA2 (TetR fused to VP64)ExpressionMammalianMutationNLS on CRY2 is mutatedPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shEsco2
Plasmid#160957PurposeEsco2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycEIF2C1
Plasmid#19871DepositorAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-500
Plasmid#19839DepositorInsertMKL1 D444-500 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-500Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only