We narrowed to 636 results for: acr.2
-
Plasmid#85613PurposeCas9-tracrRNA integration vector for Bacillus subtilisDepositorInsertcas9-tracrRNA
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pORTMAGE-2
Plasmid#72677PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Ap resistance marker.DepositorInsertmutL E32K
UseTagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterpL promoterAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2
Plasmid#231904PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging firefly luciferase mRNA into the VLPsDepositorUseLentiviralTagsExpressionMutationR203M in N proteinPromoterCMV, EF-1aAvailable sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-2
Plasmid#52378Purposeexpresses human Syndecan-1 GAGAL replaced with GADEV of SDC2 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
UseTagsExpressionMammalianMutationGAGAL of syndecan-1 replaced with of GADED of SDC…PromoterCMVAvailable sinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2.EGFP
Plasmid#231905PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging EGFP mRNA into the VLPsDepositorUseLentiviralTagsExpressionMutationR203M in N proteinPromoterCMV, EF-1aAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2
Plasmid#83899PurposeGCaMP6f expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertGCaMP6f
UseAAVTagsExpressionMammalianMutationPromotermDlxAvailable sinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEY39
Plasmid#191043Purposeacr-2(2.1k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertacr-2(2.1k) (acr-2 Nematode)
UseTagsExpressionWormMutationNonePromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY61
Plasmid#191058Purposeacr-2(3.7k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertacr-2(3.7k) (acr-2 Nematode)
UseTagsExpressionWormMutationNonePromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G1 mutant
Plasmid#231913PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098 by implementing Asn-to-Gln mutationDepositorInsertspike G1 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G12345 mutant
Plasmid#231920PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1134, N1158, N1173, N1194 by implementing Asn-to-Gln mutationDepositorInsertspike G12345 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1134Q, N1158Q, N1173Q, N1194QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G13 mutant
Plasmid#231915PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1158 by implementing Asn-to-Gln mutationDepositorInsertspike G13 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1158QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G14 mutant
Plasmid#231916PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1173 by implementing Asn-to-Gln mutationDepositorInsertspike G14 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1173QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G15 mutant
Plasmid#231917PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1194 by implementing Asn-to-Gln mutationDepositorInsertspike G15 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1194QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G145 mutant
Plasmid#231918PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1173, N1194 by implementing Asn-to-Gln mutationDepositorInsertspike G145 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1173Q, N1194QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G1345 mutant
Plasmid#231919PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1158, N1173, N1194 by implementing Asn-to-Gln mutationDepositorInsertspike G1345 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1158Q, N1173Q, N1194QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G12 mutant
Plasmid#231914PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1134 by implementing Asn-to-Gln mutationDepositorInsertspike G12 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationN1098Q, N1134QPromoterCMVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mix.2-lux M-p53BE
Plasmid#20894DepositorInsert-290 Mix.2 M-p53BE promoter luciferase
UseTagsExpressionMammalianMutationpoint mutation of the p53 binding element (p53BE)…PromoterAvailable sinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRTagsExpressionMammalianMutationPromotercmb and u6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only