We narrowed to 5,861 results for: ATC
-
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK3b_024
Plasmid#123804PurposeEncodes human NFATC2 as a Type 3b part to be used in the MTK systemDepositorAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL7 SMR1791
Plasmid#28030DepositorAvailable SinceApril 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRIS
Plasmid#120424PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3, IS150
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterconstitutiveAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
trPAGmEos3.2
Plasmid#203752PurposeEncodes the transmembrane domain from PAG/CSK, including its 2 palmitoylation sites, with mEos3.2 fused on the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-SIINFEKL
Plasmid#174601Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the SIINFEKL epitopeDepositorInsertmembrane bound CD19, SIINFEKL (ovalbumin epitope)
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-LLO-mPMEL
Plasmid#174608Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the murine hPMEL epitopeDepositorInsertmembrane GFP fused to LLO and mouse PMEL antigen
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro human lipin 1-1 shRNA
Plasmid#32019DepositorInsertlipin1 shRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC1765
Plasmid#141346PurposeMini plasmid containing minimal sequences for amplification in bacteria and two BbvCI nicking sites for introduction of modified DNA through annealing and ligation (e.g. mismatch, DNA lesions, flap).DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
UseTagsExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
sh-Myocardin
Plasmid#100768Purposeexpression of shRNA targeting MYOCDDepositorInsertsh-Myocardin
UseRNAiTagsExpressionMutationPromoterH1Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
PBB-79
Plasmid#8813DepositorAvailable SinceDec. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pW401-lenti-sg1-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189950PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg1-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #1
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-LLO-hPMEL
Plasmid#174607Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the human hPMEL epitopeDepositorInsertexpresses palmitoylated GFP w/C-term fusion of the LLO190 epitope and human hPMEL epitope
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only