We narrowed to 3,503 results for: cgas
-
Plasmid#90602Purpose3rd generation lentiviral gRNA plasmid targeting human CDCA8DepositorInsertCDCA8 (Guide Designation B5.6)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CFDP1 C12.4 gRNA
Plasmid#90625Purpose3rd generation lentiviral gRNA plasmid targeting human CFDP1DepositorInsertCFDP1 (Guide Designation C12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDC34 B8.2 gRNA
Plasmid#90593Purpose3rd generation lentiviral gRNA plasmid targeting human CDC34DepositorInsertCDC34 (Guide Designation B8.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
TPX2 H1.2 gRNA
Plasmid#90918Purpose3rd generation lentiviral gRNA plasmid targeting human TPX2DepositorInsertTPX2 (Guide Designation H1.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1 E12.1 gRNA
Plasmid#90743Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1DepositorInsertMAD2L1 (Guide Designation E12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MCM2 F5.1 gRNA
Plasmid#90758Purpose3rd generation lentiviral gRNA plasmid targeting human MCM2DepositorInsertMCM2 (Guide Designation F5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D12.1 gRNA
Plasmid#90695Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CENPJ C8.1 gRNA
Plasmid#90619Purpose3rd generation lentiviral gRNA plasmid targeting human CENPJDepositorInsertCENPJ (Guide Designation C8.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D11.1 gRNA
Plasmid#90694Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVRa33_423
Plasmid#49692DepositorInsertECF33_423
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
IFN-Beta_pGL3
Plasmid#102597PurposeIFN-beta promoter driving luciferase. Use in IFN reporter assay.DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Crys
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHW581
Plasmid#198818PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, fast kineticsDepositorInsert15xUAS::GCaMP7f-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only