We narrowed to 3,458 results for: cgas
-
Plasmid#90758Purpose3rd generation lentiviral gRNA plasmid targeting human MCM2DepositorInsertMCM2 (Guide Designation F5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D12.1 gRNA
Plasmid#90695Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CENPJ C8.1 gRNA
Plasmid#90619Purpose3rd generation lentiviral gRNA plasmid targeting human CENPJDepositorInsertCENPJ (Guide Designation C8.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D11.1 gRNA
Plasmid#90694Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVRa33_423
Plasmid#49692DepositorInsertECF33_423
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
IFN-Beta_pGL3
Plasmid#102597PurposeIFN-beta promoter driving luciferase. Use in IFN reporter assay.DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 WT
Plasmid#161990PurposeExpresses two tandem repeats of Tapp1 PH domain that binds to PI(3,4)P2. Fused to eGFPDepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL046
Plasmid#198807PurposeIn vivo neuronal inhibition through histamine-gated chloride channel. Neurons expressing HisCl1 transgene are inhibited after addition of histamine.DepositorInsert15xUAS::HisCl1-SL2-GFP::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJR014
Plasmid#198813PurposeNatural light-gated anion channels. In vivo inhibition of neurons using blue light.DepositorInsert15xUAS::GtACR2::SL2::GFP::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
INPP5D-eGFP WT
Plasmid#161998PurposeMammalian expression vector, containing a GFP tagged version of INPP5DDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHW449
Plasmid#198805PurposeDirect light-gated cation channel from Chlamydomonas reinhardtii that allows neuron deploarization through brief pulses of blue light.DepositorInsert15xUAS::hChR2(H134R)-YFP::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only