We narrowed to 17,993 results for: puro
-
Plasmid#138685PurposeExpresses a human AMPKa2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLVXPuro-mGFP-LIC2
Plasmid#66601PurposeExpresses Dynein-1 LIC2 as a mGFP fusionDepositorAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC21
Plasmid#227589PurposeLentiviral plasmid expressing human H2BC21 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-2
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-TGFa-ScNeo
Plasmid#209895PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Mito-DsRed1
Plasmid#87379PurposeRetroviral transfection of cells to express DsRed1 (Ex555, Em585) localising to the mitochondrial matrix via the transit peptide from human TXN2 (Thioredoxin).DepositorInsertTXN2 mitochondrial transit peptide (TXN2 Human)
UseRetroviralTagsDsRed1ExpressionMammalianMutationFirst 60 aa onlyPromoterRetroviral 5' LTR promoterAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b
Plasmid#23257DepositorAvailable SinceMay 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CMV-puro
Plasmid#131700Purposeexpresses CMV promoter driving puromycin resistanceDepositorArticleInsertCMV-puro
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV Puro-pGK:GFP
Plasmid#68486PurposeRetrovirus expressing GFP driven by pGK promoterDepositorInsertsPuromycin Resistance
GFP
UseRetroviralExpressionMammalianPromoterLTR and pGKAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP11 CS puroR
Plasmid#46750PurposeRetroviral vector that expresses catalytically inactive form of HA-tagged human USP11DepositorInsertUSP11 (USP11 Human)
UseRetroviralTagsHAExpressionMammalianMutationC318S--catalytically inactivePromoterCMVAvailable SinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-HsACE2 (human)
Plasmid#158081PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-IKBalpha-wt
Plasmid#15290DepositorAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro Rb shRNA
Plasmid#10670DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
attB-puro-GA donor
Plasmid#182138PurposeattB-puro-GA DNA donor for twinPE and Bxb1 mediated gene-size insertionDepositorInsertattB-GA-EGFP-EF1α-PuroR-T2A-TagBFP
ExpressionMammalianAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE.puro/TO/Flag/HuR.wt
Plasmid#110346PurposeDoxycycline inducible mammalian retroviral expression of HuR (wild type) with FLAG tagDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsFLAGExpressionMammalianPromotergagAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only