We narrowed to 13,184 results for: BASE
-
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD439
Plasmid#168465PurposeFor the insertion pf NLS-mTurquoise2-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mTurquoise2-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
Tags10xHis, c-myc, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbB8k-csg-NbMS2
Plasmid#171701PurposeArabinose-inducible csgBACEFG operon for curli fiber synthesis in which curli subunit CsgA has been fused to a nanobody targeting the coat protein of bacteriophage MS2 via a flexible linker.DepositorInsertcsgBACEFG, with nanobody fused to CsgA
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_1-pTRNA-scf 2.1 (GB2603)
Plasmid#160568PurposetRNA and scaffold 2.1 scRNA aptamer Ms2 for the assembly of GBoligomers for a single position of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_1-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E3 (GB2240)
Plasmid#160562PurposetRNA and scaffold for the assembly of GBoligomers for the third position (positon [D3_4]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInserttRNA-gRNA position E3 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-N
Plasmid#156469PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-N protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-N (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-M
Plasmid#156470PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-M protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-M (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only