We narrowed to 44,005 results for: gats
-
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
Plasmid#223226PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)DepositorInsertNr1d1 (Nr1d1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXI3
Plasmid#101518PurposeDonor Vector containing FOXI3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXI3 (FOXI3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ASCL3
Plasmid#101515PurposeDonor Vector containing ASCL3 transcription factor, part of the Human TFome CollectionDepositorInsertASCL3 (ASCL3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB3
Plasmid#101478PurposeDonor Vector containing HOXB3 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB3 (HOXB3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE1
Plasmid#101439PurposeDonor Vector containing FOXE1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE1 (FOXE1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE3
Plasmid#101429PurposeDonor Vector containing FOXE3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE3 (FOXE3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXH1
Plasmid#101431PurposeDonor Vector containing FOXH1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXH1 (FOXH1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-BSX
Plasmid#101410PurposeDonor Vector containing BSX transcription factor, part of the Human TFome CollectionDepositorInsertBSX (BSX Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB9
Plasmid#101398PurposeDonor Vector containing HOXB9 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB9 (HOXB9 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXC5
Plasmid#101399PurposeDonor Vector containing HOXC5 transcription factor, part of the Human TFome CollectionDepositorInsertHOXC5 (HOXC5 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXD8
Plasmid#101402PurposeDonor Vector containing HOXD8 transcription factor, part of the Human TFome CollectionDepositorInsertHOXD8 (HOXD8 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ETV3
Plasmid#88804PurposeDonor Vector containing ETV3 transcription factor, part of the Human TFome CollectionDepositorInsertETV3 (ETV3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA 1-205 USP7
Plasmid#131254PurposeMammalian expression of a mutant USP7 TRAF-like domain (DW164AA), with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationExpresses a mutant form of our pcDNA3.1-N-Myc_1-2…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA 535-888 USP7
Plasmid#131255PurposeMammalian expression of USP7 UBL domains 1-3, with an N-terminal Myc tag and mutations in UBL2 (corresponding to DE758AA_D764A of the full-length protein)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_535-888 USP7 …Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA + DED/AAA USP7
Plasmid#131256PurposeMammalian expression of N-terminally Myc-tagged USP7, with mutations in the TRAF-like domain (DW164AA) and UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSC-CMV-HA-Ast-3-NP-1-IRES-mCherry
Plasmid#159631Purposeexpresses HA Allatostatin-3, Neurophysin-1, IRES mCherry under the CSC promoterDepositorInsertAst (AstA Fly)
UseLentiviralTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only