We narrowed to 19,814 results for: INO
-
Plasmid#200467PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(42) (ARID1A Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(59))-PGKpuro2ABFP-W
Plasmid#200485PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(59) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(44))-PGKpuro2ABFP-W
Plasmid#200468PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(44) (ARID1A Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(37))-PGKpuro2ABFP-W
Plasmid#200480PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(37) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(96))-PGKpuro2ABFP-W
Plasmid#200477PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(96) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-A457P
Plasmid#193365Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (A457P mutation) (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationA457P (GCC to CCC)PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW5126
Plasmid#129732Purposepolyhistidine replacement of EatA passenger DUF corresponding to amino acids E541 -Q617 of the native EatA proteinDepositorInserteatA-DUF::His8
Tags9His tagExpressionBacterialMutationreplaces the domain of unknown function correspon…PromoteraraBADAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(T286I)-IRES-mCherry
Plasmid#172638PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(T286I) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationThr286IlePromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND1(P287A)-Puro
Plasmid#172641PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D1(P287A) and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND1(T286A)-Puro
Plasmid#172642PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D1(T286A) and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CCND1(P287S)
Plasmid#172644PurposeExpresses 2xFLAG-2xSTREP-tagged cyclin D1(P287S) in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CCND1(T286I)
Plasmid#172645PurposeExpresses 2xFLAG-2xSTREP-tagged cyclin D1(T286I) in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only