We narrowed to 34,171 results for: cel=
-
Plasmid#118969PurposeExpresses N-terminus of soybean mosaic virus protease (SbMVp) fused to FKBP-rapamycin binding (FRB) domainDepositorInsertsplit nSbMVp in fusion with FRB
TagsMyc tagExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXEE401BG
Plasmid#91717PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis, Bar and glyphosate-resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-mScl
Plasmid#64895PurposeLentiviral expression of Flag-tagged murine transcription factor SclDepositorInsertScl
UseLentiviralExpressionMammalianAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2
Plasmid#244110PurposeCytosolic expression of green glucose sensorDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pCX-SponGee-Kras
Plasmid#134777Purposemammalian expression of SponGee-Kras, a plasma membrane-targeted but lipid raft-excluded variant of the cGMP buffer SponGee that prevents downstream signalingDepositorInsertSponGee-Kras
TagsFLAG and mRFPExpressionMammalianPromoterCAGAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF7_P2A_Hygro_Barcode
Plasmid#120493PurposeBarcoded lentiviral vector to express KLF7 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP1-10-HygR
Plasmid#223675PurposeTo check the split GFP signals in mitochondria (1)DepositorInsertGFP1-10
ExpressionMammalianPromotercmvAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pET28b-GBP-MTn
Plasmid#154363PurposeBacterial expression of MTnDepositorInsertMTn
TagsHisExpressionBacterialAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
NLS-LucWT-GFP
Plasmid#127709PurposeThe expressed ORF encodes nucleus location signal with GFP and WT Luciferase.DepositorInsertLuciferase
TagsEGFP and FLAG-NLSExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
mNG-sfTq2
Plasmid#124218PurposeCytoplasmic mNeongreen superfolder mTurquoise2 tandem, ~60 % energy transfer. pNM044 - pSAV057-mNG-sfTq2DepositorInsertmNG-sfTq2
ExpressionBacterialAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ddo_opsin
Plasmid#107630PurposeIn situ hybridization and RNAi studies in planariansDepositorInsertopsin
UseRNAi; In situ hybridizationAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAE teo-GFP
Plasmid#83958PurposeCan be used to produce inducible SIV-derived vector. Cells tranduced by lentiviral particles will overexpress GFP upon activation of the tetO promoter.DepositorInsertTetO-GFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNR64
Plasmid#79540PurposeInput plasmid: expresses two recombinases downstream of two inducible promoters. Same as Dual-Recombinase-Controller (plasmid #44456) from Endy Lab except with KanR instead of CamR on the backbone.DepositorInsertsTP901
BxbI
TagsHis tag and LAA degradation tagExpressionBacterialAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTAL-MajSat-FLAG-NLS-MCS
Plasmid#69073PurposeExpresses TALE for mouse major satellite with FLAG tag under CAG promoterDepositorInsertTALE
ExpressionMammalianAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSETb-pHlash
Plasmid#61550PurposeFusion of Rluc8 and cpVenus. Expression of pHlash in Escherichia coli for protein purificationDepositorInsertpHlash
TagsHisExpressionBacterialPromoterT7Available SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEnt L1L3 tTA-2
Plasmid#24414DepositorTypeEmpty backboneUseGateway CloningAvailable SinceJune 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α bHLH* P405A/P531A Δ820-870-pBabe-Puro
Plasmid#25957DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only