We narrowed to 9,260 results for: CAG
-
Plasmid#77250Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK2DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TRIB3 gRNA (BRDN0001146652)
Plasmid#77200Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
NRBP2 gRNA (BRDN0001147825)
Plasmid#76453Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-192-Reporter
Plasmid#71872PurposeMammalian expression vector for the analysis of miR-19α activityDepositorInsertReverse complementary sequence of miR-192
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
W45A mutant of H3K9me3 biosensor
Plasmid#120808PurposeFRET biosensor. Disrupting HP1 binding capability in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1(W45A mutation)-EV linker-ECFP-mouse histone H3
ExpressionMammalianMutationTryptophan 45 is mutated to Alanine 45 on HP1 dom…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
K9L mutant of H3K9me3 biosensor
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
ExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP
Plasmid#64216PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFPExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF1438
Plasmid#143807PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
nLuc-GLP-1R-His-FLAG
Plasmid#124831PurposeExpresses N-terminally NanoLuc-Tagged GLP-1R in mammalian cellsDepositorInsertGLP1R (GLP1R Synthetic, Human)
UseLuciferaseTagsFLAG, His6, and NanoLucExpressionMammalianPromoterCMVAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
shYAP1 # 2
Plasmid#42541DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA1
Plasmid#92312PurposeCRISPR-GFP-gRNA for cutting WT1DepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCX-DI-2A
Plasmid#74671PurposeMammalian expression of DI-2A (hCD73/F2A/hCD39)DepositorAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Xla.Tubb2:hGCGR-TEVcs-QF;he1.1:CFP
Plasmid#218857PurposeXla.Tubb2 promoter driving expression of human glucagon receptor, TEV protease recognition site, QF fusion protein for use in trans-Tango.DepositorAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only