We narrowed to 69,707 results for: nin
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pInducer-myc-ERK1-R84S
Plasmid#213591PurposeDoxycycline inducible expression of myc-tagged ERK1-R84S cDNA in mammilian cellsDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6-GFP
Plasmid#50486Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
TagsGFP fusion in M3-M4 loop (after residue A405)ExpressionMammalianMutationGly-Ala-Gly flexible linker flanking the GFP open…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3-YFP
Plasmid#50484Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChRBeta3 subunit, isoform 1 (Chrnb3 Mouse)
TagsYFPExpressionMammalianMutationYFP fusion in M3-M4 loop (after residue P379). O…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29(+exo) (LM2990)
Plasmid#208958PurposeA variant CE1 construct with ePhi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(M8R/V51A/M97T/G197D/E221K/…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
GNAS_pLX307
Plasmid#98339PurposeLentiviral expression of GNASDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFAP [N206A/8R]
Plasmid#177512PurposeMammalian Expression Plasmid of anti-GFAP (Human). Derived from hybridoma N206A/8.DepositorInsertanti-GFAP (Homo sapiens) recombinant mouse monoclonal antibody (GFAP Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1012 - pAAV EF1a DIO Nuc-eYFP
Plasmid#75082PurposeAn AAV packaging vector that expresses Cre-dependent nuclear-localized eYFP under control of the EF1a promoter.DepositorInsertNuc-eYFP
UseAAV and Cre/LoxTagsNLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp14-nsp10 fusion (SARS-CoV-2)
Plasmid#169160PurposeTo express nsp14-nsp10 fusion protein in E. coliDepositorInsert14His-SUMO-nsp14-GGSGGS-nsp10 (ORF1ab SARS-CoV-2, Synthetic)
Tags14His-SUMO and Fusion protein of SARS-CoV-2 nsp14…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCherry-Rab11
Plasmid#140573PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorTagsmCherryExpressionMammalianPromoterCMV IE94Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1-Hypa
Plasmid#218166PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLgw ELK4-V5-EcoDam
Plasmid#98607PurposeMammalian DamID lentiviral vector for ELK4 with Dam-V5 using Gateway cloningDepositorInsertELK4 (Elk4 Mouse)
UseLentiviral; DamidTagsV5 and Dam (DNA adenine methyltransferase)ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_HERPUD1_PHACTR3
Plasmid#205828PurposeExpress mEGFP-tagged fusion protein, HERPUD1_PHACTR3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-ePhi29 fusion - pCMV-T7-PCV2-ePhi29 (JO1420)
Plasmid#217805PurposeUnfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1
Plasmid#218164PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIB_3xFlag-His6-nsp13 (SARS-CoV-2)
Plasmid#169189PurposeBaculoviral transfer vector to express 3xFlag-His6-nsp13 (SARS-CoV-2) in insect cellsDepositorInsert3xFlag-His6-nsp13 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag-His6ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-His6-3xFlag/nsp7/nsp8 (SARS-CoV-2)
Plasmid#169185PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag, nsp7 and nsp8 (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7/nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only